ID: 1148797299

View in Genome Browser
Species Human (GRCh38)
Location 17:50203208-50203230
Sequence TGGAATCTTGGATGGTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148797299_1148797315 17 Left 1148797299 17:50203208-50203230 CCCCCAAACCATCCAAGATTCCA No data
Right 1148797315 17:50203248-50203270 TCTCCACGCCCTCCCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148797299 Original CRISPR TGGAATCTTGGATGGTTTGG GGG (reversed) Intergenic
No off target data available for this crispr