ID: 1148798469

View in Genome Browser
Species Human (GRCh38)
Location 17:50208925-50208947
Sequence CTGGAGGCCTGGGATTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148798455_1148798469 25 Left 1148798455 17:50208877-50208899 CCATAGGCAGAGGAAGATAAGGC No data
Right 1148798469 17:50208925-50208947 CTGGAGGCCTGGGATTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148798469 Original CRISPR CTGGAGGCCTGGGATTCTGG GGG Intergenic
No off target data available for this crispr