ID: 1148800717

View in Genome Browser
Species Human (GRCh38)
Location 17:50223671-50223693
Sequence TGTGATCCTCAAAATTTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148800717_1148800720 10 Left 1148800717 17:50223671-50223693 CCTTGTAAATTTTGAGGATCACA No data
Right 1148800720 17:50223704-50223726 TTGTAGAGTGTCTCTTGGTTTGG No data
1148800717_1148800721 11 Left 1148800717 17:50223671-50223693 CCTTGTAAATTTTGAGGATCACA No data
Right 1148800721 17:50223705-50223727 TGTAGAGTGTCTCTTGGTTTGGG No data
1148800717_1148800719 5 Left 1148800717 17:50223671-50223693 CCTTGTAAATTTTGAGGATCACA No data
Right 1148800719 17:50223699-50223721 TGATTTTGTAGAGTGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148800717 Original CRISPR TGTGATCCTCAAAATTTACA AGG (reversed) Intergenic
No off target data available for this crispr