ID: 1148805588

View in Genome Browser
Species Human (GRCh38)
Location 17:50262290-50262312
Sequence CCTTGTGGTGGCTCCATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148805588_1148805603 28 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805603 17:50262341-50262363 TCCTGGCCCTCAGGGCCTTATGG No data
1148805588_1148805602 20 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805588_1148805597 2 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805597 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
1148805588_1148805600 11 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805600 17:50262324-50262346 AGGGCAACTGCAGGCAATCCTGG No data
1148805588_1148805601 19 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805601 17:50262332-50262354 TGCAGGCAATCCTGGCCCTCAGG No data
1148805588_1148805593 -9 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805593 17:50262304-50262326 ACCACAAGGTACCGGCCTCCAGG No data
1148805588_1148805595 -8 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805595 17:50262305-50262327 CCACAAGGTACCGGCCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148805588 Original CRISPR CCTTGTGGTGGCTCCATTGG AGG (reversed) Intergenic