ID: 1148805590

View in Genome Browser
Species Human (GRCh38)
Location 17:50262293-50262315
Sequence GTACCTTGTGGTGGCTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148805590_1148805601 16 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805601 17:50262332-50262354 TGCAGGCAATCCTGGCCCTCAGG No data
1148805590_1148805600 8 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805600 17:50262324-50262346 AGGGCAACTGCAGGCAATCCTGG No data
1148805590_1148805602 17 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805590_1148805597 -1 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805597 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
1148805590_1148805603 25 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805603 17:50262341-50262363 TCCTGGCCCTCAGGGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148805590 Original CRISPR GTACCTTGTGGTGGCTCCAT TGG (reversed) Intergenic