ID: 1148805596

View in Genome Browser
Species Human (GRCh38)
Location 17:50262315-50262337
Sequence CCTGCAGTTGCCCTGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148805596_1148805602 -5 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805596_1148805601 -6 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805601 17:50262332-50262354 TGCAGGCAATCCTGGCCCTCAGG No data
1148805596_1148805608 13 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805608 17:50262351-50262373 CAGGGCCTTATGGCATAAAAGGG No data
1148805596_1148805603 3 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805603 17:50262341-50262363 TCCTGGCCCTCAGGGCCTTATGG No data
1148805596_1148805607 12 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805607 17:50262350-50262372 TCAGGGCCTTATGGCATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148805596 Original CRISPR CCTGCAGTTGCCCTGGAGGC CGG (reversed) Intergenic