ID: 1148805598

View in Genome Browser
Species Human (GRCh38)
Location 17:50262319-50262341
Sequence ATTGCCTGCAGTTGCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148805598_1148805607 8 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805607 17:50262350-50262372 TCAGGGCCTTATGGCATAAAAGG No data
1148805598_1148805608 9 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805608 17:50262351-50262373 CAGGGCCTTATGGCATAAAAGGG No data
1148805598_1148805602 -9 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805598_1148805601 -10 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805601 17:50262332-50262354 TGCAGGCAATCCTGGCCCTCAGG No data
1148805598_1148805603 -1 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805603 17:50262341-50262363 TCCTGGCCCTCAGGGCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148805598 Original CRISPR ATTGCCTGCAGTTGCCCTGG AGG (reversed) Intergenic