ID: 1148805602

View in Genome Browser
Species Human (GRCh38)
Location 17:50262333-50262355
Sequence GCAGGCAATCCTGGCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148805596_1148805602 -5 Left 1148805596 17:50262315-50262337 CCGGCCTCCAGGGCAACTGCAGG No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805598_1148805602 -9 Left 1148805598 17:50262319-50262341 CCTCCAGGGCAACTGCAGGCAAT No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805594_1148805602 5 Left 1148805594 17:50262305-50262327 CCACAAGGTACCGGCCTCCAGGG No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805588_1148805602 20 Left 1148805588 17:50262290-50262312 CCTCCAATGGAGCCACCACAAGG No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805592_1148805602 8 Left 1148805592 17:50262302-50262324 CCACCACAAGGTACCGGCCTCCA No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data
1148805590_1148805602 17 Left 1148805590 17:50262293-50262315 CCAATGGAGCCACCACAAGGTAC No data
Right 1148805602 17:50262333-50262355 GCAGGCAATCCTGGCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148805602 Original CRISPR GCAGGCAATCCTGGCCCTCA GGG Intergenic