ID: 1148807122

View in Genome Browser
Species Human (GRCh38)
Location 17:50269526-50269548
Sequence GGTCACCTCATTGCCAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148807122_1148807130 26 Left 1148807122 17:50269526-50269548 CCCTCCTTGGCAATGAGGTGACC No data
Right 1148807130 17:50269575-50269597 TACGAGAGTCCTGAGGAGCCAGG No data
1148807122_1148807127 2 Left 1148807122 17:50269526-50269548 CCCTCCTTGGCAATGAGGTGACC No data
Right 1148807127 17:50269551-50269573 GCTAGAGGCCTTGTTGAATATGG No data
1148807122_1148807129 19 Left 1148807122 17:50269526-50269548 CCCTCCTTGGCAATGAGGTGACC No data
Right 1148807129 17:50269568-50269590 ATATGGCTACGAGAGTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148807122 Original CRISPR GGTCACCTCATTGCCAAGGA GGG (reversed) Intergenic
No off target data available for this crispr