ID: 1148808824

View in Genome Browser
Species Human (GRCh38)
Location 17:50277920-50277942
Sequence GTGGAAGTCCCCGAGTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 70}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148808824_1148808828 1 Left 1148808824 17:50277920-50277942 CCAACAAACTCGGGGACTTCCAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1148808828 17:50277944-50277966 CTTGCAGGCAGGTCTGTAGCTGG 0: 1
1: 0
2: 1
3: 17
4: 186
1148808824_1148808832 30 Left 1148808824 17:50277920-50277942 CCAACAAACTCGGGGACTTCCAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1148808832 17:50277973-50277995 GTCCTTCCTACTGCAGTGCCAGG 0: 1
1: 1
2: 2
3: 25
4: 253
1148808824_1148808829 8 Left 1148808824 17:50277920-50277942 CCAACAAACTCGGGGACTTCCAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1148808829 17:50277951-50277973 GCAGGTCTGTAGCTGGATCCCGG 0: 1
1: 0
2: 3
3: 18
4: 202
1148808824_1148808826 -10 Left 1148808824 17:50277920-50277942 CCAACAAACTCGGGGACTTCCAC 0: 1
1: 0
2: 0
3: 7
4: 70
Right 1148808826 17:50277933-50277955 GGACTTCCACACTTGCAGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148808824 Original CRISPR GTGGAAGTCCCCGAGTTTGT TGG (reversed) Intronic
901221414 1:7585995-7586017 GTAGAAATCCCCAAGATTGTGGG + Intronic
902981843 1:20129060-20129082 GTGTAAGCCACCCAGTTTGTGGG + Intergenic
905273023 1:36799367-36799389 GTTGAAGTTTCCGAGTGTGTGGG - Exonic
910498929 1:87866231-87866253 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
912945864 1:114083569-114083591 GTGGGAGTGCCTGAGTTTGCAGG + Intergenic
913321189 1:117589678-117589700 GTTTAAGTCCCAGAGTTTGAAGG - Intergenic
917608312 1:176659201-176659223 GTTTAAGACCCCCAGTTTGTGGG - Intronic
923601659 1:235408896-235408918 GTGGAAGTCTGGGAGTCTGTTGG + Intronic
1063371441 10:5525275-5525297 GTGGACTTCCCCGAGTTCCTGGG + Exonic
1067985676 10:51141079-51141101 GTGTTGGTCCCCGAGGTTGTGGG - Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1078732962 11:13992701-13992723 GAGGAAGTCTCCTGGTTTGTGGG + Intronic
1080626351 11:34034071-34034093 GTACAAGTCCTCGAGTTTGAAGG - Intergenic
1081850099 11:46269785-46269807 CTGGAGGTCCCCAAGTTTGTGGG + Intergenic
1084351235 11:68601301-68601323 GTGCACGTCTCTGAGTTTGTGGG + Intronic
1090760618 11:129833950-129833972 GTTTAAGTCCCCTAGTCTGTGGG + Intronic
1100150447 12:91730276-91730298 GGGCAAGTCCCAGAATTTGTAGG - Intergenic
1102666489 12:114578348-114578370 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1105907008 13:24822030-24822052 GTGGATGTGCCGGATTTTGTAGG + Intronic
1107556135 13:41518075-41518097 GGGGAAGTCCCCTAGTGTGTAGG + Intergenic
1109010985 13:56943720-56943742 GTGGAAGTCTCAGAGTCTGAAGG - Intergenic
1113531404 13:111030123-111030145 GTGGAACTCCCTGGGTGTGTGGG + Intergenic
1117212602 14:53516293-53516315 GTGGATGGACCAGAGTTTGTAGG + Intergenic
1125364661 15:38901187-38901209 GTGGAAATTCCCGACTTTGTAGG + Intergenic
1130330732 15:82920349-82920371 ATGTAAGCCCCCAAGTTTGTGGG - Intronic
1132421930 15:101677398-101677420 GTGTAAGTCCCAGAGTTGGTGGG - Intronic
1134782469 16:16910798-16910820 GTTTAAGTCCCCCAGTTTGTGGG - Intergenic
1135208882 16:20507201-20507223 GTGGAGCTGCCCAAGTTTGTGGG - Intergenic
1137897155 16:52226409-52226431 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1140345981 16:74213463-74213485 GTGGAAATCACTGAGGTTGTTGG + Intergenic
1140951269 16:79820111-79820133 TTTGAAGTTCCAGAGTTTGTTGG - Intergenic
1143125619 17:4639594-4639616 GTGGAAGTACCGGAGTATCTGGG - Exonic
1148808824 17:50277920-50277942 GTGGAAGTCCCCGAGTTTGTTGG - Intronic
1151286221 17:73113506-73113528 GTGAAAGTCCACGGGTCTGTAGG - Intergenic
1153185483 18:2481505-2481527 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1165147429 19:33740245-33740267 GTGGAAGTCCCCAAGCTCTTAGG + Intronic
1165221203 19:34317995-34318017 GTGGAAGCCCAGGAGTTTGGGGG + Intronic
926967271 2:18428864-18428886 GTTGAAGCCCCCAAATTTGTAGG - Intergenic
927199448 2:20569260-20569282 GTGGAAGTCTGCGATTTTGAAGG - Intronic
942866337 2:180679952-180679974 CTGGAGCTCCCCGATTTTGTTGG + Intergenic
943847361 2:192669202-192669224 GTGCAAGTCCCTGAGTTTTAAGG - Intergenic
944527915 2:200639216-200639238 CTGGAAGACTCAGAGTTTGTAGG - Intronic
947028453 2:225765088-225765110 GTGTAAGTCCCAGAGCTTGAAGG - Intergenic
1170525101 20:17228550-17228572 GTGGAGGTCCCTGAGATTTTAGG + Intronic
1170544311 20:17421290-17421312 GGGGAAGTCCCTGAGTCTGCTGG - Intronic
1179976518 21:44871302-44871324 GTGCAGGTCCCCGAGGTGGTGGG - Intronic
1184774670 22:46617230-46617252 GTGTAAGTTCCCCAGTGTGTAGG + Intronic
953638973 3:44687879-44687901 GTGCAAGTCCCAGAGTCTGAAGG + Intergenic
960138682 3:114131160-114131182 GTGGCACTCCCCGAGGTTGCAGG + Exonic
963515798 3:146306557-146306579 GTGCAAGTCCCAGACTTTGGTGG - Intergenic
965046454 3:163584562-163584584 TTGGAACTCCCCAAGGTTGTGGG - Intergenic
967405012 3:189105610-189105632 GTTGAAGTTCCCAAGGTTGTTGG - Intronic
970261381 4:14228535-14228557 GTTTAAATCCCCCAGTTTGTGGG + Intergenic
975782541 4:77854932-77854954 GTGGAAATACCAGAGTTTCTGGG + Intergenic
980548721 4:134304656-134304678 GTTGAAGACCCGGAGGTTGTAGG + Intergenic
981353703 4:143762505-143762527 GAGGCAGCCCCCGAGATTGTGGG - Intergenic
981567276 4:146114401-146114423 GTGTAAGTCCTGGAGTTTGAAGG + Intergenic
984964937 4:185131358-185131380 GAGGAAGGCCCCGAGGTTGGAGG + Intergenic
986232196 5:5876631-5876653 GTGCAAGTCTCAGAGTTTGAAGG + Intergenic
986696799 5:10364358-10364380 GTGCAAGTCCTGGAGTGTGTTGG + Intronic
990310132 5:54529915-54529937 TTGTAAGTCACCCAGTTTGTAGG - Intronic
1006292198 6:33146719-33146741 GTGCAAGTCCCTGAGTGTGAAGG + Intergenic
1006606430 6:35260324-35260346 AGGGGAGTCACCGAGTTTGTGGG - Intronic
1007073488 6:39052634-39052656 GTGGAAGCCCCCGGGGTGGTGGG - Intronic
1015961124 6:138650290-138650312 CTGGAAGTACCTGAGTATGTAGG - Intronic
1019787161 7:2984372-2984394 GTGTCAGTCCCAGAGTTTGAAGG - Intronic
1023040250 7:36166919-36166941 GTTGAAGCCCCCCAGTCTGTGGG - Intronic
1032166286 7:129547629-129547651 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
1032172826 7:129600074-129600096 GTGTAAGCCACCCAGTTTGTGGG + Intergenic
1034600642 7:152251649-152251671 GTGGAAGTTCCCCAGTCTTTGGG - Intronic
1039055428 8:33532631-33532653 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1040651599 8:49455380-49455402 GAGGAAGTGGCCGATTTTGTAGG - Intergenic
1043307300 8:78811407-78811429 GTGTATGTCCCTGAGTTTCTGGG + Intergenic
1059999826 9:119948219-119948241 GTTGAAGTCACTGAGTTTGTGGG - Intergenic
1186507440 X:10104227-10104249 GTGTAAGTCCCAGAGTCTGAAGG + Intronic
1187369639 X:18694171-18694193 ATGGATGTCCCACAGTTTGTGGG + Intronic
1195234211 X:102880836-102880858 TTGGAAGTCCCCAAATTTGCAGG + Intergenic
1200015628 X:153160552-153160574 GTGTAAGTCCCGGAGTCTGAAGG - Intergenic