ID: 1148810841

View in Genome Browser
Species Human (GRCh38)
Location 17:50290074-50290096
Sequence CTTGATTAGCAGTGCTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148810841_1148810843 13 Left 1148810841 17:50290074-50290096 CCTGACAAGCACTGCTAATCAAG No data
Right 1148810843 17:50290110-50290132 CTGACTTTTCCTGAAGTTTCAGG No data
1148810841_1148810845 25 Left 1148810841 17:50290074-50290096 CCTGACAAGCACTGCTAATCAAG No data
Right 1148810845 17:50290122-50290144 GAAGTTTCAGGCTAACAGAGAGG No data
1148810841_1148810847 27 Left 1148810841 17:50290074-50290096 CCTGACAAGCACTGCTAATCAAG No data
Right 1148810847 17:50290124-50290146 AGTTTCAGGCTAACAGAGAGGGG No data
1148810841_1148810846 26 Left 1148810841 17:50290074-50290096 CCTGACAAGCACTGCTAATCAAG No data
Right 1148810846 17:50290123-50290145 AAGTTTCAGGCTAACAGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148810841 Original CRISPR CTTGATTAGCAGTGCTTGTC AGG (reversed) Intergenic
No off target data available for this crispr