ID: 1148811078

View in Genome Browser
Species Human (GRCh38)
Location 17:50291740-50291762
Sequence CTGTGTAAAGGAATGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148811078_1148811085 4 Left 1148811078 17:50291740-50291762 CCCACCACCATTCCTTTACACAG No data
Right 1148811085 17:50291767-50291789 CCTCCTTTTTAGCTCCCATTTGG No data
1148811078_1148811089 20 Left 1148811078 17:50291740-50291762 CCCACCACCATTCCTTTACACAG No data
Right 1148811089 17:50291783-50291805 CATTTGGTTCCTGTTCCACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148811078 Original CRISPR CTGTGTAAAGGAATGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr