ID: 1148812448

View in Genome Browser
Species Human (GRCh38)
Location 17:50302344-50302366
Sequence GATTCAAATCCCTCAAACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148812448_1148812452 5 Left 1148812448 17:50302344-50302366 CCCAAGTTTGAGGGATTTGAATC No data
Right 1148812452 17:50302372-50302394 GAACAGGAAGCTGATAACCTTGG No data
1148812448_1148812454 21 Left 1148812448 17:50302344-50302366 CCCAAGTTTGAGGGATTTGAATC No data
Right 1148812454 17:50302388-50302410 ACCTTGGTAGAAGCTGATGGAGG No data
1148812448_1148812453 18 Left 1148812448 17:50302344-50302366 CCCAAGTTTGAGGGATTTGAATC No data
Right 1148812453 17:50302385-50302407 ATAACCTTGGTAGAAGCTGATGG No data
1148812448_1148812456 22 Left 1148812448 17:50302344-50302366 CCCAAGTTTGAGGGATTTGAATC No data
Right 1148812456 17:50302389-50302411 CCTTGGTAGAAGCTGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148812448 Original CRISPR GATTCAAATCCCTCAAACTT GGG (reversed) Intergenic
No off target data available for this crispr