ID: 1148812454

View in Genome Browser
Species Human (GRCh38)
Location 17:50302388-50302410
Sequence ACCTTGGTAGAAGCTGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148812448_1148812454 21 Left 1148812448 17:50302344-50302366 CCCAAGTTTGAGGGATTTGAATC No data
Right 1148812454 17:50302388-50302410 ACCTTGGTAGAAGCTGATGGAGG No data
1148812449_1148812454 20 Left 1148812449 17:50302345-50302367 CCAAGTTTGAGGGATTTGAATCA No data
Right 1148812454 17:50302388-50302410 ACCTTGGTAGAAGCTGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148812454 Original CRISPR ACCTTGGTAGAAGCTGATGG AGG Intergenic
No off target data available for this crispr