ID: 1148816044

View in Genome Browser
Species Human (GRCh38)
Location 17:50329030-50329052
Sequence GAAGTGGCTGGCTGTGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148816044_1148816058 22 Left 1148816044 17:50329030-50329052 CCTCCTCCACAGCCAGCCACTTC No data
Right 1148816058 17:50329075-50329097 CCCAGCACTGCCGTGGATTCTGG No data
1148816044_1148816052 -1 Left 1148816044 17:50329030-50329052 CCTCCTCCACAGCCAGCCACTTC No data
Right 1148816052 17:50329052-50329074 CCCACGTGCTCCCTCATAAGGGG No data
1148816044_1148816056 15 Left 1148816044 17:50329030-50329052 CCTCCTCCACAGCCAGCCACTTC No data
Right 1148816056 17:50329068-50329090 TAAGGGGCCCAGCACTGCCGTGG No data
1148816044_1148816050 -2 Left 1148816044 17:50329030-50329052 CCTCCTCCACAGCCAGCCACTTC No data
Right 1148816050 17:50329051-50329073 TCCCACGTGCTCCCTCATAAGGG No data
1148816044_1148816049 -3 Left 1148816044 17:50329030-50329052 CCTCCTCCACAGCCAGCCACTTC No data
Right 1148816049 17:50329050-50329072 TTCCCACGTGCTCCCTCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148816044 Original CRISPR GAAGTGGCTGGCTGTGGAGG AGG (reversed) Intergenic
No off target data available for this crispr