ID: 1148817167

View in Genome Browser
Species Human (GRCh38)
Location 17:50337330-50337352
Sequence GTATATGTGATCCAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148817167_1148817175 5 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817175 17:50337358-50337380 CCCTGTGGTAGATAAGCCCTGGG No data
1148817167_1148817169 -10 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817169 17:50337343-50337365 TCACATATACCCCTTCCCTGTGG No data
1148817167_1148817180 15 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817180 17:50337368-50337390 GATAAGCCCTGGGTCTTAGGGGG No data
1148817167_1148817173 4 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817173 17:50337357-50337379 TCCCTGTGGTAGATAAGCCCTGG No data
1148817167_1148817178 13 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817178 17:50337366-50337388 TAGATAAGCCCTGGGTCTTAGGG No data
1148817167_1148817179 14 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817179 17:50337367-50337389 AGATAAGCCCTGGGTCTTAGGGG No data
1148817167_1148817177 12 Left 1148817167 17:50337330-50337352 CCTGCCTTCTGGATCACATATAC No data
Right 1148817177 17:50337365-50337387 GTAGATAAGCCCTGGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148817167 Original CRISPR GTATATGTGATCCAGAAGGC AGG (reversed) Intergenic