ID: 1148818155

View in Genome Browser
Species Human (GRCh38)
Location 17:50345718-50345740
Sequence GCTCTCGGTCCCGGGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148818155_1148818161 -10 Left 1148818155 17:50345718-50345740 CCTGGGCCCCCGGGACCGAGAGC No data
Right 1148818161 17:50345731-50345753 GACCGAGAGCTTACCCGCGTGGG No data
1148818155_1148818165 21 Left 1148818155 17:50345718-50345740 CCTGGGCCCCCGGGACCGAGAGC No data
Right 1148818165 17:50345762-50345784 CGCCCACGACCCCCGACACCAGG No data
1148818155_1148818169 30 Left 1148818155 17:50345718-50345740 CCTGGGCCCCCGGGACCGAGAGC No data
Right 1148818169 17:50345771-50345793 CCCCCGACACCAGGCAAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148818155 Original CRISPR GCTCTCGGTCCCGGGGGCCC AGG (reversed) Intergenic