ID: 1148821640

View in Genome Browser
Species Human (GRCh38)
Location 17:50363494-50363516
Sequence TCCCATTCTCTCCCCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148821632_1148821640 21 Left 1148821632 17:50363450-50363472 CCTGACAGGTTCAGAGGGCAGAT No data
Right 1148821640 17:50363494-50363516 TCCCATTCTCTCCCCTGTCCAGG No data
1148821631_1148821640 24 Left 1148821631 17:50363447-50363469 CCTCCTGACAGGTTCAGAGGGCA No data
Right 1148821640 17:50363494-50363516 TCCCATTCTCTCCCCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148821640 Original CRISPR TCCCATTCTCTCCCCTGTCC AGG Intergenic
No off target data available for this crispr