ID: 1148824541

View in Genome Browser
Species Human (GRCh38)
Location 17:50382789-50382811
Sequence CTGAAGGAATGAGGAGAAAT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 4, 3: 71, 4: 636}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148824541_1148824551 19 Left 1148824541 17:50382789-50382811 CCCATTTCTCCTCATTCCTTCAG 0: 1
1: 0
2: 4
3: 71
4: 636
Right 1148824551 17:50382831-50382853 GAAGAAGTCCTACAAAGAGGAGG 0: 2
1: 0
2: 2
3: 16
4: 184
1148824541_1148824550 16 Left 1148824541 17:50382789-50382811 CCCATTTCTCCTCATTCCTTCAG 0: 1
1: 0
2: 4
3: 71
4: 636
Right 1148824550 17:50382828-50382850 AATGAAGAAGTCCTACAAAGAGG 0: 2
1: 0
2: 2
3: 29
4: 250
1148824541_1148824547 -7 Left 1148824541 17:50382789-50382811 CCCATTTCTCCTCATTCCTTCAG 0: 1
1: 0
2: 4
3: 71
4: 636
Right 1148824547 17:50382805-50382827 CCTTCAGGGAACCCTGACTAAGG 0: 1
1: 0
2: 4
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148824541 Original CRISPR CTGAAGGAATGAGGAGAAAT GGG (reversed) Exonic
901133296 1:6976380-6976402 CTGATGGGAAGGGGAGAAATAGG + Intronic
901905158 1:12402431-12402453 CTGAAGAAATGATAAGAAAGAGG + Intronic
902951205 1:19883894-19883916 CTGAAGCAATGAGCATAAACAGG - Intronic
904609729 1:31718841-31718863 ATGAATGAATGAGGAGACATTGG - Intergenic
904637991 1:31899319-31899341 CTGAAGGAATGAGAATGAATTGG - Intergenic
905277491 1:36827987-36828009 CTGAAGGCAGAAGGAGGAATGGG + Intronic
905817819 1:40965635-40965657 CCGCAGGAATGAGGAGAGAAAGG - Intergenic
906127587 1:43437071-43437093 CTGGAGGAGTGAGGACAAGTAGG + Intronic
906438985 1:45823846-45823868 CTTACTGAATGAGGAGAAAGAGG + Intronic
906460362 1:46031563-46031585 CCGAAGGAATGAGGAGTGAGAGG - Exonic
907233422 1:53022332-53022354 ATGACAGAATGTGGAGAAATGGG - Intronic
907448896 1:54529601-54529623 CTCAAGGTAAGAGGAGAAACAGG + Intergenic
907816385 1:57922080-57922102 ATGAGGGAATAAAGAGAAATGGG - Intronic
907914379 1:58855177-58855199 ATGAGGGAATGAGAAGAAAGTGG - Intergenic
908576222 1:65462632-65462654 CTGGAAGGATGTGGAGAAATAGG - Intronic
909309046 1:74122216-74122238 CTGAGAGGATGTGGAGAAATAGG - Intronic
909909476 1:81244506-81244528 TGGAAGGGATGTGGAGAAATAGG + Intergenic
909938512 1:81582962-81582984 CTGAAAGAATGAAGCAAAATAGG - Intronic
910944656 1:92577279-92577301 ATTAAGGGAGGAGGAGAAATGGG - Intronic
911063044 1:93764252-93764274 AGGAAGGAATGAGAAGAGATGGG - Intronic
911229651 1:95347559-95347581 GGGAAGGAGGGAGGAGAAATGGG - Intergenic
911255452 1:95628082-95628104 CAGAAGGGTGGAGGAGAAATAGG + Intergenic
911425573 1:97706976-97706998 CTGACAGGATTAGGAGAAATAGG - Intronic
912194969 1:107386883-107386905 CTGCAAGGATGTGGAGAAATTGG - Intronic
912233467 1:107822329-107822351 CTGGAGGAATGAGAAAAAAGAGG + Intronic
912306747 1:108575802-108575824 CTGAGGGATTGGAGAGAAATGGG + Intronic
912714857 1:111975886-111975908 CTGAAGGAATGAGGATAGCCTGG - Intronic
912724915 1:112050505-112050527 GTAAAGGAAAAAGGAGAAATGGG - Intergenic
913088340 1:115459167-115459189 CTGCAGGAAGGAGTAGAACTTGG + Intergenic
914263684 1:146020040-146020062 CTGAATGAGTGAGGAGAGATAGG - Intronic
914314324 1:146495572-146495594 CAGAAGGAATCAGGAGGAAAGGG - Intergenic
914500025 1:148237809-148237831 CAGAAGGAATCAGGAGGAAAGGG + Intergenic
914937801 1:151995121-151995143 CTAAAGGAATGAGCAGACCTGGG + Intergenic
914959341 1:152192477-152192499 CTAAAGGAATGAGAAGTTATTGG + Intergenic
915148012 1:153806802-153806824 CTGGAGGAGTGGGGAGAAAAGGG + Exonic
915296937 1:154928085-154928107 CAGAATGAATGAGGAAAAAAAGG + Intronic
915459300 1:156060315-156060337 CTGAAGGAATGAGGAGCCCCAGG - Intergenic
915459541 1:156061549-156061571 CTGAAGGAATGAGGAGCCCCAGG - Intronic
915596918 1:156901298-156901320 CTGAAGGACTGAGGAGCATGAGG - Intronic
915633652 1:157171648-157171670 CTGAAGCAATGAGGATAAGACGG + Intergenic
915641245 1:157228633-157228655 CTGGAGGAATAAGGAGTAAGAGG + Intergenic
915668242 1:157464311-157464333 CTGGAGGAATAAGGAGTAAGAGG - Intergenic
915694783 1:157728854-157728876 CTGGAGAGATGTGGAGAAATAGG + Intergenic
915743416 1:158137695-158137717 CTGAAGCGAAGAGGAGAAAGAGG - Intergenic
916368193 1:164057782-164057804 CTGGATGAATGAGAAGAAAGAGG - Intergenic
916380074 1:164199970-164199992 CTGAGAGGATGTGGAGAAATAGG + Intergenic
916661871 1:166929737-166929759 GTGAATGAATGAGGAGAAACTGG + Intronic
916875465 1:168964001-168964023 ATGGAGGAAGGAGGAGAAACAGG - Intergenic
917171974 1:172186674-172186696 CTGAAGGAATCAGAATCAATTGG + Intronic
917333258 1:173904213-173904235 ATGAAAGAATGAGTAGAAGTAGG - Intronic
917448489 1:175126835-175126857 TTGAAAGAAGGAGGAGAAATGGG + Intronic
917628269 1:176867684-176867706 TTGAAGGAAAGAGGAAAATTAGG - Intronic
918243114 1:182637340-182637362 ATGAAGGTAGGAGGAGAAATGGG - Intergenic
919334841 1:196219263-196219285 CAGGAGGAATAGGGAGAAATGGG + Intergenic
919678422 1:200409724-200409746 CTGAAGAAAGGAGGAGGAAGAGG + Intronic
920681398 1:208075587-208075609 ATGAAAGTATGATGAGAAATAGG - Intronic
920979684 1:210821623-210821645 TAGAAGGAATGTGGAGAAGTGGG + Intronic
921727848 1:218543571-218543593 CTGAAAGGATGACAAGAAATAGG + Intergenic
921784729 1:219216602-219216624 CTGAAAGGAAGAGGAGCAATAGG - Intergenic
921862377 1:220053375-220053397 TTCAAGGATTGAGGGGAAATGGG - Intergenic
921900033 1:220440352-220440374 CTGAAAGTATGAGGAGAGAAAGG + Intergenic
922112438 1:222574106-222574128 CTGGAGGGGTGGGGAGAAATGGG + Intronic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923318038 1:232800762-232800784 CTGAATGAATGACTAGAAATAGG + Intergenic
923729731 1:236538753-236538775 GTGAATGAATGAGGAGGGATTGG + Intronic
924800082 1:247322971-247322993 CACAGGGAAGGAGGAGAAATGGG + Intronic
924939201 1:248800464-248800486 CTGAAGGAAGCAGAAGAAAAGGG - Intergenic
1063337278 10:5228183-5228205 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1063904653 10:10769266-10769288 CTTAAAGAATGAGTAGAGATTGG + Intergenic
1063938958 10:11107842-11107864 TAGAAGGGATGGGGAGAAATAGG - Intronic
1064902035 10:20305374-20305396 CTGAAGAAATAAGCAGAAACTGG + Intergenic
1064994189 10:21282033-21282055 CTATAGGAATGGGAAGAAATTGG - Intergenic
1065042877 10:21715657-21715679 CATAATGAATGAGAAGAAATGGG - Intronic
1065655651 10:27946658-27946680 ATGAAGGGATGAAGATAAATTGG - Intronic
1065922185 10:30402490-30402512 CAGAGGGAATGAGGAGAGAGTGG + Intergenic
1066126774 10:32349458-32349480 ATAAAGGAATGATGAGAAAAAGG - Intronic
1066163805 10:32763814-32763836 CTGAGGGAAGGGGGACAAATGGG + Intronic
1066654466 10:37685643-37685665 ATGAAGGAATGAGAAGAGACAGG - Intergenic
1068019612 10:51564938-51564960 ATAAAGGAAGGAAGAGAAATTGG - Intronic
1068236798 10:54245676-54245698 TTGAAGGCATGAGGAGATGTGGG + Intronic
1069205740 10:65682557-65682579 CTGAAGGCACGAGTATAAATGGG + Intergenic
1069496775 10:68911524-68911546 CTGAAGAAAAGAGAAGAAAAGGG - Intronic
1071126174 10:82337616-82337638 TGGCAGGAATGTGGAGAAATAGG - Intronic
1071433803 10:85627829-85627851 CTGAAGGAAGGAGCAGGAAACGG - Intronic
1071702918 10:87961491-87961513 CTGAGGGATTGAGAATAAATTGG - Intronic
1071986229 10:91053621-91053643 CTGAAGGAAATAAAAGAAATGGG + Intergenic
1072614123 10:97038207-97038229 CTGATGGAATGAGGGGGAACTGG - Intronic
1072882838 10:99245384-99245406 TTCAGGTAATGAGGAGAAATAGG + Intergenic
1072952781 10:99862452-99862474 CTCAAAGAATGTGGAGAAAAGGG - Intergenic
1074146762 10:110723562-110723584 CTGCAAGAATGTGGAAAAATTGG - Intronic
1074555430 10:114484769-114484791 ATGAGGGGATGAGGAGAAAGTGG - Intronic
1074682228 10:115918818-115918840 CTGAAGGGATGAACAGAATTTGG + Intronic
1074822450 10:117190987-117191009 CTGAAGGGATGTGGAAAAACAGG + Intergenic
1074926472 10:118077466-118077488 CTGAGCAAATCAGGAGAAATTGG - Intergenic
1075304496 10:121355763-121355785 ATGAAGGAACGAGGATAATTGGG + Intergenic
1075511784 10:123078340-123078362 TTGCAGGATGGAGGAGAAATGGG + Intergenic
1075957262 10:126534763-126534785 TTGAAGGAATGGGGAGCAAGCGG + Intronic
1076766226 10:132635293-132635315 CAGCAGGAATGAGGGGAAAAGGG - Intronic
1076850944 10:133092724-133092746 CTGAATGAAGAAGGAGAAATAGG + Intronic
1078254359 11:9644823-9644845 CTGAAGAGATGAGGAAAGATTGG - Intergenic
1078357019 11:10640038-10640060 ATGAAGGAATGGGGAGAGAAGGG + Intronic
1078394649 11:10969931-10969953 GTGAGGGAATGGGGACAAATTGG + Intergenic
1078603561 11:12755205-12755227 CTGATGGAATGCCTAGAAATGGG - Intronic
1078846247 11:15121084-15121106 CTGATTAATTGAGGAGAAATTGG + Intronic
1079030306 11:16981695-16981717 ATGAAGGAATGAGGAGGAGTGGG + Intronic
1079312318 11:19377827-19377849 CTAAAGGAATGAAATGAAATTGG - Intronic
1080416010 11:32070541-32070563 CTGAAGGAGGGAGGAGGAAGAGG + Intronic
1080701081 11:34644645-34644667 CTGAATGAATGAGGAAGAAGAGG + Intronic
1080978574 11:37373451-37373473 CTGACTGAATGAGAAGAAAGTGG + Intergenic
1081118642 11:39236269-39236291 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1081208184 11:40299330-40299352 CTAAAGTAATAAAGAGAAATAGG - Intronic
1082759522 11:57113772-57113794 CTTGAGCAATGAGGAGTAATGGG - Intergenic
1083056943 11:59831191-59831213 CTGAAAAAATTAGGAGAAAGTGG - Intronic
1083314593 11:61806595-61806617 CTGAGGGAATGAGGAGGATGTGG - Intronic
1083484621 11:62975524-62975546 CAGAAGGAAGGAGGAGAAGCTGG + Intronic
1083628237 11:64082792-64082814 CTGAGGGAAACAGGGGAAATGGG - Intronic
1084867020 11:72067068-72067090 ATGAGGGAAAGAAGAGAAATAGG + Intronic
1085143642 11:74172034-74172056 GAGAAGGAAAGAGGAGAACTAGG + Intronic
1085183858 11:74559006-74559028 CTTAAGGAAGGAGGAGAATATGG + Intronic
1085690878 11:78662766-78662788 CTGAAGGAGAGATGAGACATGGG + Intronic
1086556056 11:88112292-88112314 TAGAAGCAATGAGGAGAAATGGG + Intergenic
1086895702 11:92309581-92309603 CTGAAGAAGAGAGGAGAAAAGGG - Intergenic
1086938275 11:92767773-92767795 AGGAAGGAATGAGGACACATGGG - Intronic
1087411308 11:97793065-97793087 CGGAAAGAATGAGAAGAAAGTGG - Intergenic
1087959170 11:104326480-104326502 CTGAAGGAAGGAGGGGAAGTGGG + Intergenic
1088304406 11:108392642-108392664 TTGCAAGAATGTGGAGAAATTGG - Intronic
1088661106 11:112047102-112047124 ATGCTGGAATGTGGAGAAATAGG - Intronic
1088924969 11:114292797-114292819 ATGATGGAGTGAGGGGAAATGGG + Intronic
1090266188 11:125354332-125354354 CTAAAGGAATGAGGAGGGAGTGG - Intronic
1090870392 11:130739703-130739725 CTGAAGACATGAGGAGAACAAGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091609746 12:1995788-1995810 CTGAAGGAGTGAGTATAAAGAGG - Intronic
1091764911 12:3113412-3113434 CTGAGGCCATGATGAGAAATTGG + Intronic
1092025352 12:5234939-5234961 CTGAAGGAAGGAGGATGAAAGGG + Intergenic
1092107974 12:5937193-5937215 TGGAAGGAATGTGGAGAAAAAGG - Intronic
1092596274 12:10008510-10008532 ATGAAGAAATAAGGAGAATTTGG + Intronic
1092703798 12:11262301-11262323 TTGAGAGAATGTGGAGAAATAGG + Intergenic
1093091673 12:14928365-14928387 TTGAAGAAAAGAGGTGAAATAGG - Intronic
1093118779 12:15243115-15243137 CTGAAAGAAGGAGGAAGAATTGG - Intronic
1094024224 12:25945453-25945475 ATGAAGCAATGATTAGAAATTGG - Intergenic
1094725490 12:33110386-33110408 CTGAGGGAAAGAGGAGTTATTGG + Intergenic
1095192597 12:39274662-39274684 CTGCAGAAATGGGTAGAAATGGG - Intergenic
1095679622 12:44958854-44958876 CTCAATGAGTGAGGAGAAAAGGG + Intergenic
1095814391 12:46405801-46405823 CGGGAGGATTGAGGAGGAATTGG + Intergenic
1096556378 12:52406530-52406552 ATCAAGGAAGGAGGACAAATAGG - Intergenic
1096738961 12:53677562-53677584 GGGAAGGAGTGGGGAGAAATAGG + Intergenic
1097704655 12:62855428-62855450 CTGAGGCAATGAGCAGAAACAGG + Intronic
1097766456 12:63532463-63532485 AAGAAGGAATGAGGAGAAAAAGG + Intergenic
1098119714 12:67223065-67223087 GTGAAGGAATGAGGGGAAAGAGG + Intergenic
1098133749 12:67379613-67379635 CTCAAGGAAGGTGAAGAAATAGG + Intergenic
1099175039 12:79411431-79411453 CTAAGGGAAGGAGGTGAAATGGG + Intronic
1099183569 12:79494186-79494208 CTGGAGAGATGTGGAGAAATAGG - Intergenic
1100732109 12:97482430-97482452 TGGAAGTAATGAGGAGTAATGGG - Intergenic
1100761705 12:97814668-97814690 ATGAAGGAAAGAGGAAAAAGAGG + Intergenic
1100958011 12:99930701-99930723 CGGAAAGGATGTGGAGAAATAGG + Intronic
1101116214 12:101533958-101533980 CTGTGGGAGAGAGGAGAAATGGG - Intergenic
1101325936 12:103716047-103716069 CTTTGGGAATGAGGTGAAATGGG + Intronic
1101766580 12:107706031-107706053 CTGGAGAGATGTGGAGAAATAGG - Intronic
1101897472 12:108767461-108767483 GTGAAAGAGTGAGAAGAAATGGG - Intergenic
1102224592 12:111218871-111218893 GTCAAGCAAAGAGGAGAAATGGG - Intronic
1102336791 12:112088031-112088053 CTGAGGGAAAGAGGAGACAGAGG - Intronic
1103235589 12:119369841-119369863 ATGAATGAATGTGGTGAAATGGG + Intronic
1104472193 12:129038189-129038211 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1104497263 12:129252549-129252571 CTGAGAGGATGTGGAGAAATAGG + Intronic
1104515236 12:129419155-129419177 CTCAAGGAAATAGAAGAAATAGG - Intronic
1105276657 13:18934974-18934996 CTAAAGGAATGAAGACAAAGAGG - Intergenic
1105355847 13:19658765-19658787 CTGAAGGCATAAAGATAAATAGG - Intronic
1105534417 13:21251020-21251042 TGGAAAGAATGTGGAGAAATAGG - Intergenic
1105682294 13:22741428-22741450 TGGAAGGAATGAGGAGAGATTGG + Intergenic
1106019973 13:25905159-25905181 CTTCAGGAATGAGGAGAAGATGG - Intronic
1107107437 13:36660281-36660303 ATGAAGGAAAGAGGAGAAATGGG + Intergenic
1107261020 13:38491332-38491354 CTTAAAGAATGATGATAAATAGG + Intergenic
1107580575 13:41779994-41780016 AGGAAGGAATCAGGGGAAATGGG - Intronic
1108032811 13:46254173-46254195 GTGATGGAATGGGAAGAAATTGG + Intronic
1108259742 13:48644624-48644646 CTGAAGGAAAGAGGAAAATCAGG + Intergenic
1108305124 13:49123853-49123875 CTGGAGAGATGTGGAGAAATAGG + Intronic
1108446232 13:50511574-50511596 AGGATGGAAGGAGGAGAAATTGG + Intronic
1108544889 13:51482870-51482892 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1108549725 13:51531866-51531888 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1109033180 13:57219962-57219984 TGTAAGGAATGCGGAGAAATAGG - Intergenic
1109399620 13:61808436-61808458 TGGAAGGGATGTGGAGAAATAGG + Intergenic
1109410885 13:61967452-61967474 CTAAAGGAATGAGTATAAACTGG - Intergenic
1110005281 13:70258072-70258094 CTGGAGGCAGGAGAAGAAATGGG + Intergenic
1110946792 13:81431535-81431557 CTGAGGAAAGGAAGAGAAATGGG - Intergenic
1111446086 13:88347738-88347760 CGGAAGGAATGAGGGAAAAAGGG + Intergenic
1111919269 13:94393652-94393674 AGGGAGGAATGGGGAGAAATGGG - Intronic
1112405456 13:99115887-99115909 CTGGAGGGATGTGGAGAAATAGG + Intergenic
1112794667 13:103043251-103043273 GTGAAGGATTGAGAAGCAATGGG + Intergenic
1113249033 13:108430851-108430873 TTGAAGGCATGATGAGAAACAGG - Intergenic
1113380586 13:109801868-109801890 CTGAAGGAAAGTGAAGAAGTAGG - Intergenic
1113591917 13:111507344-111507366 CTGGAGGGATGAGGTGAAACTGG - Intergenic
1114252570 14:20973610-20973632 TTGGAGGAGTGAGGAGAGATGGG - Intergenic
1114786349 14:25604224-25604246 CAGAAGGAATTTGGAGGAATTGG + Intergenic
1115049559 14:29041082-29041104 ATGAAGTACAGAGGAGAAATAGG - Intergenic
1115074919 14:29376714-29376736 CTGAAGAAATGCAGATAAATAGG + Intergenic
1115819306 14:37197168-37197190 CTGAAGGAATCATGAGTAACAGG + Intergenic
1116088006 14:40266294-40266316 CTGAGGGGATGTGGAGAAATAGG + Intergenic
1116178365 14:41503571-41503593 CTAAAGGAAAGGGGAGAAAATGG + Intergenic
1116285111 14:42960962-42960984 CTGAAGTAATGAGGATAACTTGG + Intergenic
1116553545 14:46273761-46273783 CTGAATGATTGAGGAGAGAATGG - Intergenic
1117005308 14:51415250-51415272 CTGAATGAATGGGCAGAAACTGG - Intergenic
1117322138 14:54634324-54634346 ATGAATGAATGAATAGAAATAGG + Intronic
1117356508 14:54928835-54928857 CCAATGGAATAAGGAGAAATTGG - Intergenic
1117407870 14:55422002-55422024 TTAAAGTAATGAGGGGAAATTGG + Intronic
1117611148 14:57484642-57484664 TTGAAGGAATGGAAAGAAATTGG + Intronic
1117859636 14:60076050-60076072 CGGAGAGAATGTGGAGAAATAGG - Intergenic
1118150028 14:63179373-63179395 CCAAAGGAAGGAGGAGAAAAAGG - Intergenic
1118564683 14:67126604-67126626 TTGAAAGGATGTGGAGAAATAGG + Intronic
1118605305 14:67498594-67498616 ACGAAGGAATGAGCAGAATTAGG + Intronic
1119631669 14:76237486-76237508 CTGAAGGCAGGAGCAGAAAGGGG - Intronic
1119793207 14:77372582-77372604 CTCAAGGGCTGAAGAGAAATTGG - Intronic
1120375784 14:83705382-83705404 CTGTAAGAATGAGGAGGATTAGG - Intergenic
1120619441 14:86745660-86745682 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1120841649 14:89090898-89090920 CAGTAGGAATGAAGAGAAACAGG - Intergenic
1120999346 14:90440320-90440342 CTGAGGGAACGAGGAGACAAGGG + Intergenic
1121101245 14:91251981-91252003 CTGAGGGAAGGAGGAGCACTTGG - Exonic
1121419112 14:93799767-93799789 TTGAAGGAATGAATGGAAATAGG + Intergenic
1121819844 14:96957518-96957540 CTCAAAGAATGAGGACAAAATGG - Intergenic
1122126447 14:99581112-99581134 CTGAAGCAAAGAGGAGGAGTGGG + Intronic
1202873031 14_GL000225v1_random:181687-181709 GTGAAGAAATGAAGAGAACTAGG + Intergenic
1202890339 14_KI270722v1_random:150903-150925 CTAAAGGAGTGTGGAGGAATAGG - Intergenic
1123770272 15:23521751-23521773 CTGAAAGAATTTGGAGAAATAGG - Intergenic
1124082194 15:26511099-26511121 CACAAGGAATGAGAAGAATTGGG - Intergenic
1124856130 15:33391121-33391143 CTGGAGGGATGAGGGGAAAGAGG - Intronic
1125453327 15:39831772-39831794 CTGATGGAAGGAGGAGACAGAGG - Intronic
1125548762 15:40528622-40528644 CAGAAGGCCTGAGGAGAGATTGG + Intergenic
1125983882 15:44030239-44030261 GTGAGGGAAGGAGGGGAAATTGG + Intronic
1126305143 15:47247213-47247235 TTGGAGGAATGAGGAGAAAAGGG + Intronic
1126463608 15:48939684-48939706 ATGAAAGAATAAGAAGAAATTGG - Intronic
1126818048 15:52473025-52473047 CGGAGAGAATGTGGAGAAATAGG - Intronic
1127625583 15:60776857-60776879 CTAAGGGAAGGAGGAAAAATAGG - Intronic
1127709707 15:61584124-61584146 CAGAGGGAATGTGGAGAAAGTGG + Intergenic
1128326212 15:66725820-66725842 TTGGAGAAATGAGGTGAAATGGG + Intronic
1128457460 15:67840267-67840289 ATGAAGGAATCATGGGAAATAGG + Intergenic
1128831502 15:70773360-70773382 CTGAAGGAGAGCAGAGAAATAGG + Intergenic
1129834485 15:78693488-78693510 CAGAGGGAATGAGGAGAGAGTGG - Intronic
1129935053 15:79440358-79440380 CTGAAGCAAATGGGAGAAATGGG + Intronic
1131571152 15:93537793-93537815 CTGAAGGGATCGGGAGAAAAAGG - Intergenic
1131798200 15:96042270-96042292 TGGAAGGGATGTGGAGAAATTGG + Intergenic
1132155432 15:99492547-99492569 CTCCAGGACTGAGGAGGAATGGG + Intergenic
1132219087 15:100091649-100091671 CTGAAAACATGAGGAAAAATGGG - Intronic
1132738415 16:1398755-1398777 CTGGAGCAAGGAGGAGAAAGGGG + Exonic
1133501453 16:6371215-6371237 ATGAAGGATTGATGACAAATCGG - Intronic
1133573567 16:7065790-7065812 CTGGAGGATTTAGGAGATATTGG - Intronic
1133658394 16:7889658-7889680 CTGAATGAATGAGGAAAATAAGG + Intergenic
1133866532 16:9649135-9649157 CAGGAGGGATGAAGAGAAATTGG + Intergenic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1134625922 16:15722628-15722650 CTGATGGGAAGAGGAGAAACTGG + Intronic
1135344191 16:21674268-21674290 TAGAAAGAATGAGGAGAAACTGG - Intergenic
1135543517 16:23350479-23350501 CCTAAGGAATGAGTAGAAGTTGG + Intronic
1135877007 16:26211778-26211800 CTGAATGAATGAGTACAAAGAGG + Intergenic
1136076306 16:27819711-27819733 CTGAAGTTATGATGAGGAATTGG + Intronic
1136294518 16:29293923-29293945 CGGTAAGAATGTGGAGAAATCGG - Intergenic
1137970295 16:52978013-52978035 CTGAATGAATGAAGAGCAATTGG - Intergenic
1138208884 16:55146254-55146276 CTGGAGGAATGGGAAGAATTTGG - Intergenic
1138624667 16:58240883-58240905 CAGTAAGAATGTGGAGAAATTGG - Intronic
1138958452 16:62000434-62000456 CTTAAGCCATGTGGAGAAATAGG - Intronic
1139051092 16:63125324-63125346 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1139289281 16:65842759-65842781 CTGCAAGGATGTGGAGAAATTGG + Intergenic
1139734204 16:68973244-68973266 AAGAAGGAATAAGTAGAAATAGG - Intronic
1140169278 16:72586290-72586312 CTGAGAGGATGTGGAGAAATAGG + Intergenic
1140810434 16:78571957-78571979 CTGGAAGGATGTGGAGAAATAGG + Intronic
1142100424 16:88267967-88267989 CGGTAAGAATGTGGAGAAATCGG - Intergenic
1142817904 17:2442062-2442084 AAGAAGGAATGTGGAGAAGTTGG + Intronic
1143666121 17:8361971-8361993 CTGAAGAAATGAGTTTAAATAGG - Intergenic
1143987563 17:10928112-10928134 CAGAAGGAATGAAGAAAAAAAGG + Intergenic
1144839315 17:18175876-18175898 CTGGAGGAATGAGCAGAGATGGG - Intronic
1144960818 17:19043011-19043033 CTGAAGGATTGAGCTGACATTGG - Intronic
1144974342 17:19131513-19131535 CTGAAGGATTGAGCTGACATTGG + Intronic
1145748570 17:27338907-27338929 CTAAAGGAATGAGTAGGAAGTGG + Intergenic
1147193103 17:38748460-38748482 CTGAAGGAATGAGGTCACGTGGG - Intronic
1147497049 17:40926732-40926754 CTGAAGGAGAGCAGAGAAATTGG - Intronic
1147957591 17:44145043-44145065 ACTAAGGAATGAGAAGAAATGGG - Intronic
1148272322 17:46271609-46271631 CTAAAGGAATTAGCAGAAATAGG + Intergenic
1148567905 17:48644607-48644629 CGGAAGGAATGAGGAGGGAAAGG - Intergenic
1148824541 17:50382789-50382811 CTGAAGGAATGAGGAGAAATGGG - Exonic
1149073931 17:52575758-52575780 CAGAAGGACTAAGGAGAATTAGG + Intergenic
1149827774 17:59845207-59845229 TGGAAGGAAAGAGGAGAAAAGGG + Intergenic
1150607102 17:66702430-66702452 TTGGAGGAATGAGGAGATGTTGG + Intronic
1150721214 17:67615748-67615770 AAGAAGGAACGGGGAGAAATTGG + Intronic
1150763593 17:67985724-67985746 CTAAAGGAATTAACAGAAATAGG - Intergenic
1150829881 17:68510072-68510094 CTGCAGGAAGAGGGAGAAATGGG + Intergenic
1150848235 17:68680602-68680624 TGGAAGGAAAGGGGAGAAATTGG + Intergenic
1150976913 17:70097808-70097830 ATGAAGGAAAGAGAAGAAAATGG - Intronic
1152891127 17:82882263-82882285 CTGAAGGAGGCAGGAGAAACAGG - Intronic
1153522616 18:5966757-5966779 CTGAAGGAATGGGGAAAGAGTGG - Intronic
1153838940 18:8989116-8989138 CTGAAGGAAGGAGTCGAAAATGG - Intergenic
1154042846 18:10875421-10875443 ATCAAGGAATGAGAAAAAATGGG + Intronic
1154051546 18:10964291-10964313 CTGAAGCAATAAGAAAAAATAGG + Intronic
1154500679 18:14995877-14995899 CTAAAGCAATGAGGAGAGAAGGG + Intergenic
1155116603 18:22774689-22774711 CTGACGGAATAAAGAGAAGTGGG - Intergenic
1156099038 18:33571719-33571741 CTGAAGGCATGAGGAGTGACTGG + Intergenic
1156110632 18:33722109-33722131 CTGAAGAAAGGGAGAGAAATGGG - Intronic
1156171335 18:34490098-34490120 CTGCAGGAAGAAGGAGACATTGG + Intergenic
1156309014 18:35905666-35905688 CTGTGGGAATGAGGAGTAAGCGG + Intergenic
1157212077 18:45751955-45751977 CTGAATGAATAAACAGAAATAGG + Intronic
1158701350 18:59750794-59750816 CTAAAGGCTTGTGGAGAAATGGG - Intergenic
1159245285 18:65797810-65797832 TTGAAAGACAGAGGAGAAATAGG - Intronic
1160367071 18:78335485-78335507 CAGAAGGAGGGAGGAGAAGTAGG + Intergenic
1161362030 19:3855835-3855857 CGGAAGGAATGAGGGGAGATGGG + Intronic
1162752441 19:12836997-12837019 CTGTAGGGATCAGGAGATATGGG - Intronic
1163106756 19:15127732-15127754 CTGAAGATATACGGAGAAATTGG - Intergenic
1163291018 19:16378976-16378998 CAAAAGGAATGGGCAGAAATAGG + Intronic
1163317177 19:16548786-16548808 CTTAAGTAATGGGGAAAAATGGG + Intronic
1163806467 19:19401874-19401896 CTGAGGGACTGAGAAGAAATTGG - Intronic
1164307745 19:24019737-24019759 CTGGAGGAATGGGGAGAAAGGGG + Intergenic
1165195608 19:34100446-34100468 CTAAAGGAATGAGGAGTTATTGG + Intergenic
1166158038 19:40930043-40930065 CTGAAAGAATGAGGTAAAAGAGG + Intergenic
1166166905 19:40997072-40997094 CTGAAAGAATGAGGTAAAAGAGG + Intronic
1166638547 19:44473580-44473602 GAGCAGGAATGTGGAGAAATGGG + Intergenic
1166938456 19:46349040-46349062 CTGAAGGGGAGTGGAGAAATGGG + Intronic
1167796447 19:51712791-51712813 CTGGAGGTTTGAGGAGAAAAGGG + Intergenic
1168064241 19:53910038-53910060 CTGGAGGAATAAGGAGATCTGGG + Intronic
1168228743 19:55015166-55015188 CTGGAGGAATGAGGAGAGGCAGG + Intronic
1168429778 19:56269260-56269282 TTGAGGGGATGTGGAGAAATTGG - Intronic
1202665761 1_KI270708v1_random:117732-117754 CTAAAGGAGTGTGGAGGAATAGG - Intergenic
925332394 2:3068683-3068705 TGGAGGGAATGTGGAGAAATGGG + Intergenic
925574000 2:5341246-5341268 CTGGGGGTGTGAGGAGAAATGGG + Intergenic
925885074 2:8388470-8388492 CTGAAGGACAGAGGAGAAAGGGG + Intergenic
925896526 2:8476548-8476570 CAGCAGGAATGAGGTGATATGGG + Intergenic
925904477 2:8531277-8531299 CTGAAAGAATGAGAAAGAATGGG + Intergenic
926408436 2:12577618-12577640 CTCAATGAATGAGGAGAGTTTGG - Intergenic
926500676 2:13649190-13649212 GAGAAGGAAACAGGAGAAATTGG + Intergenic
926613218 2:14968702-14968724 TTCCAAGAATGAGGAGAAATTGG + Intergenic
926620025 2:15039271-15039293 CTGAATGAATGAGTGGAAAATGG + Intergenic
926685351 2:15693741-15693763 TTGAGGGAAGGAGGATAAATAGG + Intronic
927257997 2:21057351-21057373 GTGAAGGAAAGAGGAGATATGGG + Intergenic
927334272 2:21903954-21903976 CTGGAGAGATGTGGAGAAATAGG - Intergenic
928012789 2:27626528-27626550 CAAAAGGAATGAGGATAAACTGG + Intronic
928389914 2:30901352-30901374 TTGAGTGAATGGGGAGAAATGGG - Intergenic
929418693 2:41769216-41769238 AGGAAGCAATGAGGAAAAATGGG - Intergenic
929531793 2:42757243-42757265 CTGGAGGTATGAGGTGTAATAGG + Intergenic
929614096 2:43294762-43294784 CAGAAGGAATCAGGAGAAGGTGG + Intronic
930377077 2:50581598-50581620 GGGAACTAATGAGGAGAAATAGG + Intronic
930531916 2:52598775-52598797 CTCAATGAATAAGGAGAAATTGG + Intergenic
930767272 2:55096877-55096899 CTCAAGGAATGAGGTGTAGTTGG + Intronic
931070630 2:58644766-58644788 CTGAAGGGTTGAAGAGAAAATGG + Intergenic
931231221 2:60376382-60376404 CAGAAAGAATGAGGAGTAAATGG + Intergenic
931255856 2:60571862-60571884 CTGATGGAACTAGGAGAATTGGG + Intergenic
932378967 2:71264535-71264557 CAGCAAGAATGTGGAGAAATTGG - Intergenic
932484542 2:72075696-72075718 CTGAGGGAATGCGGAGAGGTGGG - Intergenic
932859497 2:75274945-75274967 CTAAAGGAAAAAGGAGAAATGGG - Intergenic
934530480 2:95084184-95084206 CTGAAGAAGGTAGGAGAAATTGG - Intergenic
934663166 2:96153923-96153945 CTGAAGGAATCAGGGGACATTGG - Intergenic
935037153 2:99388860-99388882 CTGAAAGAATGTGCAGGAATTGG + Intronic
935461440 2:103340588-103340610 CTGAAGGGATTAGAAGGAATTGG + Intergenic
935527586 2:104190116-104190138 CTGAAGAAAGGAGGAGAAAGCGG - Intergenic
935999123 2:108807942-108807964 AGGAAGGAATGTGGAGAAGTTGG - Intronic
936274482 2:111082531-111082553 TGGAAAGAATGTGGAGAAATAGG + Intronic
936845344 2:116824384-116824406 CTGAGAGGATGTGGAGAAATAGG + Intergenic
938310633 2:130286297-130286319 CTGGAGGCATGAGGACAAATGGG - Intergenic
938499877 2:131826206-131826228 CTAAAGCAATGAGGAGAGAAGGG + Intergenic
938753185 2:134354836-134354858 CAGAAGGAGTGAGCAGGAATGGG - Intronic
938996951 2:136689878-136689900 TTGAAGGAATGAGAACAAACTGG + Intergenic
939505723 2:143044466-143044488 CTGAGAGGATGTGGAGAAATAGG - Exonic
940672032 2:156682331-156682353 TTGCAGGAATGAGAAGTAATTGG + Intergenic
940959934 2:159773976-159773998 CTGAAGAAATGTTGAGAAAATGG - Intronic
941081002 2:161060504-161060526 CTGAAGCACTGAGTAGAAATGGG - Intergenic
941483918 2:166054822-166054844 CTGATGGAGTGATAAGAAATTGG - Intronic
941771558 2:169350832-169350854 CTGAAGAAAGAAGGAAAAATAGG - Intronic
941849421 2:170164350-170164372 CTGCAGGAATGAGGAGAGTTAGG - Intergenic
942554909 2:177161991-177162013 TTGAGGGGAAGAGGAGAAATGGG + Intergenic
943007232 2:182400659-182400681 CTAAAGGCATGAAGAGAAAGCGG + Intronic
943463613 2:188200445-188200467 GTGAAGGAAGTTGGAGAAATGGG - Intergenic
943687685 2:190836320-190836342 CTGATGAAAAGAGGAGACATAGG + Intergenic
943825231 2:192382680-192382702 CTGAAGGAAAGAAGATAATTTGG + Intergenic
944100788 2:196023909-196023931 CTTAGGAAAGGAGGAGAAATGGG + Intronic
945692119 2:213049881-213049903 CTGCAGTAAGGAGAAGAAATGGG + Intronic
945945715 2:215993920-215993942 CTGGAGAGATGTGGAGAAATAGG + Intronic
946296724 2:218790092-218790114 CTGACCAAAAGAGGAGAAATTGG - Intronic
946450272 2:219773672-219773694 CTGCAGGATAGAGGAGAGATTGG - Intergenic
947024150 2:225717412-225717434 ATGAACAAATGGGGAGAAATTGG + Intergenic
947138135 2:226995476-226995498 CAGAAGAAATGAGGAGACAGCGG + Exonic
947615627 2:231555127-231555149 CTGAAGGTCTCAGGAGAACTTGG + Intergenic
947982952 2:234425694-234425716 CTGGAGGAATGAGGAGGTTTGGG + Intergenic
948537894 2:238659704-238659726 ATGAAGGAATGAGAAGAGACAGG - Intergenic
1169708270 20:8532712-8532734 TTGGAGGAAGGAGAAGAAATGGG + Intronic
1169843492 20:9965140-9965162 CAGAGGAGATGAGGAGAAATGGG + Intergenic
1170656750 20:18294009-18294031 CTGAAAGTTTGAAGAGAAATAGG + Intronic
1171045191 20:21803969-21803991 TTGAAAGAATGAATAGAAATTGG + Intergenic
1172626141 20:36348218-36348240 AAGAAGGAAGGAGGAGATATGGG + Intronic
1173074853 20:39808025-39808047 CTGTAGGAAAGAGGGGAAAATGG - Intergenic
1174530028 20:51204267-51204289 TTGAAGGAATGCAGAGAAGTAGG - Intergenic
1174707024 20:52667551-52667573 GTGAAGGAAGGAGGAGAGAAAGG - Intergenic
1175083830 20:56443016-56443038 CTGAAGTCATGGGGAGGAATGGG + Intronic
1176263313 20:64194683-64194705 GTGAGTGAGTGAGGAGAAATGGG + Intronic
1177351870 21:19953494-19953516 CTGCAAGGTTGAGGAGAAATAGG + Intergenic
1178268343 21:31166317-31166339 GAGAAGGAAAGAGAAGAAATGGG + Intronic
1178427908 21:32493548-32493570 ATGAAAGAAAGAGCAGAAATTGG - Intronic
1178685421 21:34706959-34706981 CTGATGGAAGGAGCAGCAATGGG - Intronic
1179343175 21:40531633-40531655 CTTAAGGAAGGAGGAGAGATGGG + Intronic
1179412305 21:41171213-41171235 CTGAAGGAAAGAGGAGATGGGGG - Intronic
1179805415 21:43834245-43834267 CAGAAGGAAGGAAGTGAAATGGG - Intergenic
1180285063 22:10737830-10737852 GTGAAGAAATGAAGAGAACTAGG - Intergenic
1180332474 22:11494662-11494684 CTAAAGGAGTGTGGAGGAATAGG - Intergenic
1181592836 22:23895427-23895449 ACGAAGGGATGAGGAGAAGTTGG + Exonic
1183600169 22:38835461-38835483 CTGAAGGAAAGAAGACAAATGGG + Intronic
1183952290 22:41358519-41358541 CTGGGGGAATGCGGAGAAAAGGG + Exonic
1184425327 22:44405916-44405938 GGGAAGGAATGAGGAGAGAGAGG - Intergenic
1184925442 22:47633238-47633260 CTGGAGGGAGGAGGAGACATGGG + Intergenic
949237985 3:1833891-1833913 ATGGAGGAATGAGGTGAAATTGG - Intergenic
949296023 3:2524147-2524169 GGGAGGGATTGAGGAGAAATGGG - Intronic
949446244 3:4136980-4137002 CGGAGGGGATGTGGAGAAATAGG + Intronic
951274099 3:20663992-20664014 CAGAAGGAAAGGGGAGAAAGAGG - Intergenic
951277792 3:20710895-20710917 CTGAAGGAGAGAGGAGGAAGTGG + Intergenic
951774089 3:26289136-26289158 CTAAAGGAAAGGAGAGAAATGGG + Intergenic
952045076 3:29309214-29309236 CTGAAAAAAAGAGGAGATATAGG + Intronic
952677971 3:36055806-36055828 TTGCAGGCATGAGTAGAAATAGG + Intergenic
952732092 3:36649364-36649386 CAGATGGAATGAGGAGAAACAGG - Intergenic
952776122 3:37048233-37048255 ATGAAAGAATAAGAAGAAATGGG - Intronic
953068789 3:39499444-39499466 CTGCAGGAAGAAGGAGTAATGGG - Intronic
955330475 3:58043014-58043036 CTGATAGACTGAGGAGGAATTGG + Intronic
956017322 3:64897402-64897424 AGGAAGGAAAGAGGAGAAACTGG + Intergenic
956223915 3:66934697-66934719 CTTAAGGAGTGAGGGGAAAATGG - Intergenic
956502758 3:69904573-69904595 CGGAAGGAGTGAGTAGAGATTGG - Intronic
957228654 3:77482265-77482287 CTGAAGAAATGACCAGAAATAGG - Intronic
957383793 3:79469326-79469348 CTGAAATAATGAGAAGTAATTGG + Intronic
957562236 3:81837133-81837155 TTGAATGAGTGAGGTGAAATTGG - Intergenic
958996345 3:100909776-100909798 CTGAGAGGATGTGGAGAAATAGG + Intronic
959401702 3:105910580-105910602 CTTAAATAATGAGCAGAAATTGG + Intergenic
959663481 3:108895711-108895733 CTGAAGTGATGAAGGGAAATTGG + Intergenic
959792271 3:110376164-110376186 CTGATGAAATGAGGTAAAATGGG - Intergenic
959809079 3:110594197-110594219 CTGTTGCAAAGAGGAGAAATTGG - Intergenic
960583798 3:119302437-119302459 CTGAAGGGAAGAGGAGGAAGAGG + Intronic
960622065 3:119646682-119646704 ATCAAGGACTGAGAAGAAATTGG + Intronic
960663421 3:120086390-120086412 CTGAAGTGATGAAGAGAACTGGG - Intronic
961297437 3:125897677-125897699 CCTTAGGAATGAGGAGAAAAAGG + Intergenic
961939283 3:130620604-130620626 ATGAAGGAAGGGGGAGAGATAGG + Intronic
962372214 3:134830222-134830244 CTGAAGTAATTAGGAGTAAATGG - Intronic
962722038 3:138184999-138185021 CTTAAGTAATGAGTAGAAATTGG - Intergenic
962864253 3:139434330-139434352 TTGAATGAATGAGCTGAAATTGG - Intergenic
962887766 3:139643220-139643242 TTGCAAGAATGTGGAGAAATGGG + Intronic
962925890 3:139993145-139993167 ATGAGGGAATGAGAAGAAAGAGG - Intronic
963268717 3:143265026-143265048 CTGAAGGAATGAAGAGAGCAGGG - Intergenic
963576788 3:147070341-147070363 CTGGAGGGATGTGGAAAAATAGG - Intergenic
964851189 3:161097923-161097945 CTGAATGAATGAATAGCAATTGG + Intronic
965042150 3:163522499-163522521 TTGAAGCCATGTGGAGAAATAGG - Intergenic
965764431 3:172115162-172115184 TTGAAAGAATGAGGAGACACAGG - Intronic
965803799 3:172521558-172521580 CTGGAAGGATGTGGAGAAATAGG + Intronic
965818357 3:172659823-172659845 CTGAAGGAAAGGGGAAAGATGGG - Intronic
965830449 3:172780690-172780712 TTTAAAGAATGTGGAGAAATTGG - Intronic
965836930 3:172863107-172863129 CTTAATGAATGAGGATAATTAGG + Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966963740 3:184968513-184968535 CGGAAAGGATGTGGAGAAATTGG - Intronic
967319326 3:188179792-188179814 CTGAATGAAAGAGGAGGAAGAGG - Intronic
967373315 3:188772924-188772946 AAGAAGGAAGGAGGAGAACTTGG + Intronic
967487852 3:190055005-190055027 CTGAAGGAAGGAAAAGGAATTGG - Intronic
967999622 3:195195910-195195932 CTGAGGCAGTGAGGAGAAAGAGG - Intronic
968649992 4:1756749-1756771 CTGAAGGGATGAGAAGAACTTGG + Intergenic
968892588 4:3378208-3378230 CTGAAGTCATATGGAGAAATGGG + Intronic
969483432 4:7458857-7458879 CCTAAGGAATGAGCAGAAGTTGG + Intronic
969547198 4:7838100-7838122 CTCAGGGAAGAAGGAGAAATGGG + Intronic
969966652 4:11003447-11003469 CTGAAGACAGGAGGAGAAAATGG - Intergenic
970125238 4:12802288-12802310 CTGAATGAATGATGAGTAATGGG - Intergenic
970193253 4:13534291-13534313 CTGAAGGCATATGGAGAACTTGG + Intergenic
970258173 4:14191664-14191686 CAGAGAGAATGTGGAGAAATAGG - Intergenic
970732757 4:19126253-19126275 GTGAAGGAAAGAGGAGAATGTGG + Intergenic
971147019 4:23988418-23988440 CTGGGGGAATGTGGAGAAATAGG - Intergenic
971452152 4:26810239-26810261 CTGGGGGAGTGAGGGGAAATGGG - Intergenic
971557421 4:28031676-28031698 CTAAAGGAATAAAGAGAAAAAGG - Intergenic
972664744 4:41154149-41154171 CTGGAGAACTGGGGAGAAATTGG - Intronic
973605045 4:52578281-52578303 CTGAAGTAATCAGGAGCAAAGGG + Intergenic
974441100 4:61918601-61918623 CTTAAGGAATGAGGAGCACCAGG + Intronic
974537150 4:63187222-63187244 TAGAAGGACTAAGGAGAAATAGG + Intergenic
974585109 4:63863970-63863992 TGGAGGGAATGTGGAGAAATAGG + Intergenic
974991645 4:69098779-69098801 CTGAAAGAAAGATGGGAAATGGG + Intronic
975308817 4:72879405-72879427 TAGAAGGGATGGGGAGAAATAGG - Intergenic
975328809 4:73090822-73090844 CAGAAGGCATGAGCAGAAGTAGG + Exonic
975351801 4:73355589-73355611 CTGAAGTATTGAGGAGAGAATGG - Intergenic
975380199 4:73691088-73691110 CTGAGAGGATGTGGAGAAATAGG + Intergenic
975452071 4:74540190-74540212 GTGAATGAATGAAGAGAATTAGG - Intergenic
975805192 4:78105083-78105105 CTGATGCCAGGAGGAGAAATTGG - Intronic
976281565 4:83332104-83332126 CTGAAGGAATAAGGAAAGAGAGG - Intronic
976450505 4:85185087-85185109 CTGAAGACATCAGGAGAAGTTGG - Intergenic
976517137 4:85981952-85981974 GGGAAGGAAAGAGGAGCAATGGG - Intronic
977208398 4:94190138-94190160 CTGAAAGGATGAGTTGAAATAGG - Intergenic
977464702 4:97369300-97369322 CGGGAAGAATGTGGAGAAATTGG - Intronic
978094661 4:104761404-104761426 CAGCAGGAATGAAGGGAAATGGG - Intergenic
978679976 4:111368454-111368476 CTGAAGGAAGAAGGACAAATCGG + Intergenic
978973999 4:114846202-114846224 GGGAAGGAGTGAGGTGAAATAGG + Intronic
979544610 4:121925545-121925567 GAGATGGAATGAGGAGATATTGG + Intronic
980296778 4:130929324-130929346 TGGAAGGAAGGAGGAGAAAGGGG + Intergenic
980676349 4:136087874-136087896 GTAAAGGAATGAGCATAAATAGG + Intergenic
980806662 4:137824305-137824327 TTGAAACCATGAGGAGAAATGGG + Intergenic
980849234 4:138360241-138360263 CTGAGAGGATGTGGAGAAATAGG + Intergenic
981208440 4:142071845-142071867 TGGAGGGAATGTGGAGAAATAGG + Intronic
981944751 4:150328168-150328190 GTAAAGCAATGAGCAGAAATAGG + Intronic
982464545 4:155713818-155713840 CTCAAAGAATGAGGAGAGAATGG + Intronic
982776578 4:159447954-159447976 ATTAAGAAATGAGGAGAAACAGG + Intergenic
983076179 4:163330028-163330050 CTCAAGGAAAGAGAAGAAATGGG + Intronic
985193214 4:187400255-187400277 CAGGAGGAATGAGGAGGAAGGGG - Intergenic
985993679 5:3584536-3584558 AGGAAGGAAGGAAGAGAAATGGG + Intergenic
985993712 5:3584664-3584686 CAGGAGGAAGGAAGAGAAATGGG + Intergenic
985993762 5:3584871-3584893 CAGAAGGAAGGAAGAGAAATGGG + Intergenic
985993834 5:3585146-3585168 AGGAAGGAAGGAAGAGAAATGGG + Intergenic
986443770 5:7803477-7803499 CTGTAGGAAGGAAGAGGAATGGG - Intronic
986564321 5:9096326-9096348 CAGGGGGAATGAGGAGATATAGG - Intronic
986711366 5:10490334-10490356 AGGAAGGAAAGAGAAGAAATGGG - Intergenic
987263336 5:16225852-16225874 GTGAGGGCATGAGGTGAAATTGG + Intergenic
988131959 5:27118281-27118303 CTAAAGAAATGATGAGATATGGG + Intronic
988893832 5:35650456-35650478 GTGAAAGAATGAGAAGAAATTGG - Intronic
988913128 5:35865592-35865614 TGGAGGGAATGTGGAGAAATAGG - Intronic
989322546 5:40153417-40153439 AGGAAGGAATGGGGAGAAATTGG + Intergenic
989975148 5:50576820-50576842 CTGAAGGACTGAAAAGAAAAAGG + Intergenic
990147706 5:52781310-52781332 ATGTAAGAATGAAGAGAAATTGG - Intergenic
990523180 5:56599519-56599541 CTGAGGGGAGGAGGAGGAATGGG + Intronic
990736796 5:58873106-58873128 CTGTGGGAATGGGGAGGAATAGG + Intergenic
991392748 5:66165906-66165928 TTCAAAGAATGAGGAAAAATAGG + Intronic
991428341 5:66515677-66515699 CTGAAGAAAGGGGGAGAGATGGG + Intergenic
991431756 5:66555326-66555348 CAGCAAGAATGTGGAGAAATTGG - Intergenic
991539372 5:67709483-67709505 CTGAGAGGATGTGGAGAAATAGG + Intergenic
991546305 5:67785511-67785533 CTGAGAGGATGTGGAGAAATAGG + Intergenic
991690685 5:69222375-69222397 TAGATGGAATGAGGATAAATAGG + Intronic
992049368 5:72928903-72928925 TTGAAGGACTAAGGAGAATTAGG + Intergenic
993331130 5:86601593-86601615 CTGTAAGAATGTGGAGAAAAGGG + Intergenic
993572960 5:89565791-89565813 CTAAAAGAATAAGGAGAAGTGGG + Intergenic
993756835 5:91742175-91742197 TTGAATGAATGAGGAGGCATTGG + Intergenic
994103185 5:95916333-95916355 TTGAAGGAATGAGGAGAGAAGGG + Intronic
994763157 5:103882278-103882300 CTCAAGAAATGCAGAGAAATTGG - Intergenic
995350886 5:111174264-111174286 CTCAAGGACTAAGGTGAAATAGG - Intergenic
996624710 5:125556617-125556639 CTGAAGAACTGAGCAGAAGTAGG + Intergenic
996690092 5:126331062-126331084 GGGAAGGAATGAGGAGATGTTGG + Intergenic
997247241 5:132360326-132360348 CTGAAAGACTGAGGGGAAAAGGG + Intergenic
997860820 5:137414183-137414205 GTGAAGGATAGAGGAGGAATAGG - Intronic
997987138 5:138510915-138510937 CTGAAGGACTGGGGAACAATGGG + Intronic
998542448 5:142995520-142995542 CGGAAAGGATGTGGAGAAATAGG + Intronic
999370917 5:151054803-151054825 GTGAATGAATGAGGAGGAACTGG + Intronic
1000915853 5:167080459-167080481 CTGAATGAATGATTTGAAATAGG + Intergenic
1000994655 5:167946453-167946475 CTGCTTGAATCAGGAGAAATAGG - Intronic
1001600554 5:172925595-172925617 TAGAAGGAAGGAGGAGACATCGG - Intronic
1003076445 6:2987512-2987534 CTGCAGCAATGTGGACAAATAGG + Intergenic
1003469386 6:6415113-6415135 TTGATGAAATGATGAGAAATTGG - Intergenic
1003831638 6:10018265-10018287 GTGAAGGAATGACTAGAAAAGGG - Intronic
1004531366 6:16458277-16458299 CAGAAGGACTAAGGAGAATTAGG + Intronic
1005043426 6:21620075-21620097 CTGAACGAAGGATGAGAACTTGG - Intergenic
1005218884 6:23563428-23563450 CAGAAGGTAAGAGGAGAATTTGG - Intergenic
1005218991 6:23564452-23564474 CAGAAGGTAAGAGGAGAATTAGG - Intergenic
1006088668 6:31615198-31615220 AGGAAGGAATGAGGGGAAAGGGG + Exonic
1006817639 6:36863603-36863625 GTGAAGGGATGTAGAGAAATAGG - Intronic
1008179522 6:48311193-48311215 TGGAAGGAACCAGGAGAAATAGG - Intergenic
1008603853 6:53121439-53121461 GGGTAGGAATGAGGAGAGATGGG - Intergenic
1009418944 6:63443759-63443781 CTGGTGGAATGAGGAGAAATGGG + Intergenic
1009488157 6:64252137-64252159 CTGAAGCACTAAAGAGAAATTGG - Intronic
1009814945 6:68720984-68721006 CTAAATGGATGTGGAGAAATAGG + Intronic
1010386147 6:75283347-75283369 CAGAAGGAATCAAGAGAACTTGG + Intronic
1010532987 6:76990337-76990359 CTGAAAGAAAGAAGGGAAATGGG + Intergenic
1010910412 6:81548383-81548405 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1010911089 6:81557612-81557634 CTGAAGGAATGAGCTGCAGTAGG - Intronic
1011889382 6:92138222-92138244 CTGAGGATAGGAGGAGAAATGGG + Intergenic
1012174843 6:96068318-96068340 CTTAAGGAATGAGTAGAAGATGG + Intronic
1012441553 6:99266216-99266238 TAGAAGGAATAAGGAGAATTAGG - Intergenic
1012694740 6:102364676-102364698 CTGAAAGAATGTAGAGATATAGG + Intergenic
1013724745 6:113080157-113080179 AGGAAGGAAGGAAGAGAAATTGG + Intergenic
1013756891 6:113472293-113472315 CTGACTGGATGTGGAGAAATAGG - Intergenic
1014072452 6:117198811-117198833 CTGAAGGCATCAAGAGAGATGGG + Intergenic
1014696210 6:124624221-124624243 CTGAAGAAAGGAAGAGAAATGGG + Intronic
1014869518 6:126575286-126575308 CTGTAGGATTGAGCAGAAATTGG - Intergenic
1015058270 6:128930246-128930268 CAGTAGGAATGAAAAGAAATAGG - Intronic
1015550852 6:134411032-134411054 CTGAAAGAATTTGGAGAAATAGG - Intergenic
1015551117 6:134413377-134413399 CTGAAAGAATCTGGAGAAACAGG - Intergenic
1015787536 6:136933192-136933214 CTGGAGGATTGGGAAGAAATGGG - Intergenic
1015850945 6:137571677-137571699 CTGAAAGAATCAGGAAAAAGCGG + Intergenic
1016627715 6:146191704-146191726 CTGAAAAAAAGAAGAGAAATTGG - Intronic
1016734661 6:147463862-147463884 TGGCAGGAATGTGGAGAAATTGG - Intergenic
1016744004 6:147558738-147558760 CAGAAGGAATGAAGACAGATGGG - Intronic
1016776963 6:147915221-147915243 CTGAAGTACCTAGGAGAAATGGG + Intergenic
1017133279 6:151126490-151126512 CTAAAGCAATGAGGAGAGAAGGG + Intergenic
1017244815 6:152212276-152212298 CTGGAGGATTGGGAAGAAATGGG - Intronic
1017450557 6:154550999-154551021 CAGAAGTAAAGAGGAGAAATGGG + Intergenic
1018398760 6:163401890-163401912 CAGCAGGGATGAGGAGAGATTGG + Intergenic
1018501300 6:164413476-164413498 TGGAAGGGATGAGGAGAAAGTGG - Intergenic
1020603442 7:10305671-10305693 CTTTGGGAGTGAGGAGAAATTGG - Intergenic
1020840360 7:13210064-13210086 ATGAGGGAATGAGGAGATAATGG - Intergenic
1021044987 7:15911884-15911906 CCCAAGGAATGAGGAGAAAGAGG + Intergenic
1021525627 7:21583936-21583958 TAGAGGGAATGTGGAGAAATAGG + Intronic
1021938769 7:25658169-25658191 TTGAATGAATGAGTAAAAATGGG - Intergenic
1022023172 7:26421126-26421148 GTGAAGGTTTGAGGAGAAACAGG + Intergenic
1022247169 7:28571516-28571538 CTGAGGCATTGAGGAAAAATTGG + Intronic
1022327261 7:29343698-29343720 CTGAAGGGATGAGAAGAAGAGGG - Intronic
1022651129 7:32276252-32276274 CTGAGGCAAAGAGAAGAAATAGG + Intronic
1022687363 7:32609316-32609338 GAGAAGAAATGAGGAGAAACAGG + Intergenic
1022845945 7:34209842-34209864 ATGAAGGAAAGAGGAGAATAAGG - Intergenic
1023452061 7:40297133-40297155 CTGAAGGAAAGAGAAGAAAAAGG - Intronic
1023682402 7:42701093-42701115 CAGAAAGAAGGAGGAGAAATAGG - Intergenic
1024375243 7:48629917-48629939 ATGTAGGAATGAGAAGAATTGGG + Intronic
1024947389 7:54823814-54823836 TTGAAGGACTGCGTAGAAATAGG - Intergenic
1024967389 7:55036093-55036115 ATGGAGGCATGAGGAGAAATGGG + Intronic
1025157546 7:56622023-56622045 CTTAAAGAATGATGAGAACTTGG + Intergenic
1026540974 7:71279757-71279779 CTGGAGGAACGAAGCGAAATGGG + Intronic
1028263881 7:88699167-88699189 CTTGAGGAATTAGGAGAAATGGG - Intergenic
1028397334 7:90385357-90385379 GTGGAGGATTGAGGAGATATTGG + Exonic
1028696370 7:93717676-93717698 AGGAAGAAATGGGGAGAAATGGG + Intronic
1028777816 7:94700456-94700478 TAGAAGGGATGTGGAGAAATTGG + Intergenic
1029206618 7:98872902-98872924 CTGAAGGACTTGGGAGGAATTGG + Intergenic
1029953107 7:104608004-104608026 CTGAGAGGATGTGGAGAAATAGG + Intronic
1030662270 7:112232970-112232992 CTTAAGGAATGAGCAGGAGTTGG - Intronic
1030785474 7:113655388-113655410 GGGAAGGAATGAAGAGTAATGGG + Intergenic
1031942224 7:127801243-127801265 TTTAAAGAATGTGGAGAAATAGG - Intronic
1031978823 7:128111048-128111070 CAGAAGGAAGGAGAAGAACTGGG + Intergenic
1032224944 7:130023724-130023746 CTGAAGGAAAGGGGAGATAATGG + Intronic
1033004796 7:137550057-137550079 CTGAAAGACTTATGAGAAATGGG - Intronic
1033477759 7:141707037-141707059 GGGAAGGAATTAGGAGAAAGTGG + Intergenic
1034279154 7:149839490-149839512 CTGGAAGTATGAGGATAAATAGG + Intronic
1035351103 7:158247096-158247118 CTCAAGGAATGAGGAGGTGTGGG + Intronic
1035549036 8:506033-506055 CTGAATGGGTGAGGAGAAAGAGG - Intronic
1036074587 8:5481480-5481502 GAAAAGGAATGAAGAGAAATAGG - Intergenic
1036640250 8:10579102-10579124 CTGAAGGATGGAGGAGAGACAGG - Intergenic
1036932563 8:12970300-12970322 GTGAATAAATGAGGAGAAATAGG - Intronic
1037206788 8:16331614-16331636 CAGAAGCAATGAGCAGAGATGGG - Intronic
1037551942 8:19982981-19983003 TTGCAGTAATCAGGAGAAATTGG - Intergenic
1037596148 8:20355873-20355895 CGGAGAGAATGGGGAGAAATAGG - Intergenic
1038079870 8:24122037-24122059 TTCAAGGAGTGATGAGAAATTGG + Intergenic
1038322184 8:26537680-26537702 CTGAAGTATTAAGGGGAAATGGG - Intronic
1038410791 8:27357621-27357643 CTGAATGAGAGAGGGGAAATGGG + Intronic
1038430788 8:27497798-27497820 CAGAAGGACTAAGGAGAATTAGG - Intronic
1039712209 8:40067330-40067352 CTGAAGGAAGGAGAAGAGAAGGG - Intergenic
1039963760 8:42269499-42269521 AGGAAGGAAGGAGGAGAGATAGG + Intergenic
1039999685 8:42565559-42565581 TAGAAGGAATAAGGAGAATTAGG - Intergenic
1041253537 8:55958240-55958262 GTGCAGGAAAGAAGAGAAATTGG - Intronic
1041343336 8:56869319-56869341 CTGAAGGCAGGAGGAGGAACTGG - Intergenic
1041529951 8:58854273-58854295 CTGAAAGGATGAGAAGAAATGGG - Intronic
1041876544 8:62694212-62694234 GAGAATGAATGAGGAGAATTTGG - Intronic
1041911512 8:63093834-63093856 CTGAATTACTAAGGAGAAATTGG - Intergenic
1042331787 8:67588162-67588184 TTGAAGCAATGAAGAGAAATAGG + Intronic
1042435454 8:68759442-68759464 CTGAAACAATGAGGATGAATGGG - Intronic
1042888397 8:73578599-73578621 CTGAAGCAATTGGGAGCAATGGG - Intronic
1043674081 8:82927458-82927480 CAGAAGGAAGGAGGAGAATGAGG + Intergenic
1043976749 8:86593253-86593275 AGGAAGGAAAGAGGAGAAAAAGG + Intronic
1043981065 8:86640172-86640194 TTGATAGAAGGAGGAGAAATTGG - Intronic
1044160100 8:88902407-88902429 TGGAAAGAATGTGGAGAAATAGG + Intergenic
1044377546 8:91494386-91494408 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1044500948 8:92955920-92955942 GATAAGGAATGTGGAGAAATTGG + Intronic
1044869658 8:96606558-96606580 GTGAAGGAGTAAGGAGAACTGGG + Intronic
1045051143 8:98327097-98327119 CTGAAGAAATGAGAAGATCTTGG - Intergenic
1045618601 8:103948195-103948217 TTGCAAGAATGTGGAGAAATTGG + Intronic
1046338297 8:112819367-112819389 CTGCTGGAATGTGGAGGAATTGG - Intronic
1046983230 8:120359913-120359935 AGGAAGGAAAGAGGAGAAGTAGG - Intronic
1047247839 8:123160391-123160413 CTGTAGGAATTAGAAGAAAAGGG + Intergenic
1048407551 8:134138719-134138741 CTGAAGGAAGGAGGACATTTCGG - Intergenic
1048440869 8:134458240-134458262 CAGGAGGAATGGGGAGAATTAGG + Intergenic
1050089558 9:2003767-2003789 CTGAAAGGATGTGGTGAAATTGG + Intergenic
1050754806 9:8989340-8989362 AAGGAGGAATGAAGAGAAATTGG - Intronic
1051120538 9:13747390-13747412 CTGAAGGAATCAAGGGCAATGGG + Intergenic
1051222807 9:14868366-14868388 CTTCAGGAAAGAGGAGAAATTGG + Intronic
1051547210 9:18290301-18290323 CTGCAGGGGTGTGGAGAAATTGG + Intergenic
1051989391 9:23133163-23133185 AAGAAGGAAGGAAGAGAAATGGG + Intergenic
1052951021 9:34211722-34211744 GTTAAGGAATGGGAAGAAATGGG - Intronic
1053374866 9:37597148-37597170 CTGAAGGAATGAGGAAGGAGAGG - Intronic
1053480380 9:38412423-38412445 GTGATGGAATGAGGAGATAGGGG - Intronic
1054860363 9:69946261-69946283 ATGTAGGAAAGAGGAGACATAGG - Intergenic
1054998830 9:71425374-71425396 CTGAACACATGGGGAGAAATAGG - Intronic
1055696319 9:78889032-78889054 CTGAAGGGAGCAGAAGAAATGGG - Intergenic
1055857352 9:80706051-80706073 CTGAAGGCTTGAGGAGAAAAAGG - Intergenic
1056818315 9:89817670-89817692 CAGAAGGAAGGAGGAGGAACTGG + Intergenic
1056898226 9:90571556-90571578 CAGAAGGAGAGAGGAGAATTTGG + Intergenic
1057040219 9:91842618-91842640 CTGAGGCAATGAGGAGAAATGGG + Intronic
1057169508 9:92952745-92952767 ATGAAGGAAGGAGGAAAAAAGGG - Intronic
1058439170 9:104991580-104991602 AGGAAGGAACGAGGAGTAATGGG + Intergenic
1058445042 9:105047418-105047440 CTCAAGGACTGATGAAAAATAGG - Intergenic
1058712982 9:107697257-107697279 CTGCAGCAATGAGGAGAAGATGG + Intergenic
1058787005 9:108398766-108398788 GTGAAGGTTTGAGGAGAAACAGG + Intergenic
1058849811 9:109000743-109000765 TTCAAGGAATGAGGTGAAGTCGG + Intronic
1058854615 9:109048965-109048987 CTGTAGGACAGAGGAGAAACAGG + Intronic
1058930495 9:109714485-109714507 AAGAAGGAATGGGGTGAAATTGG - Intronic
1059305919 9:113352984-113353006 CTTAATGAATGAGGATAACTTGG + Intronic
1059761250 9:117339763-117339785 GTGAAGGAAGAAGGAGAAAGGGG + Intronic
1059865857 9:118513195-118513217 CTGAATGAATGAGGTTAGATAGG - Intergenic
1060016251 9:120088794-120088816 TTGCAGGAATGAGCATAAATGGG - Intergenic
1062315321 9:135964348-135964370 CTGGAGGAAGGAGGAGGGATGGG + Intergenic
1062353982 9:136153251-136153273 CTGGAGGGATCAGGAGAAAAGGG + Intergenic
1203731426 Un_GL000216v2:94858-94880 GTGAAGAAATGAAGAGAACTAGG - Intergenic
1187500093 X:19832522-19832544 CTGAAGGAATGAGGAGAGAGGGG + Intronic
1187677824 X:21735373-21735395 CTGTAAGAATAAGGAAAAATAGG + Intronic
1188171663 X:26935358-26935380 TTGAAAGAATGAGGAGAGAAAGG + Intergenic
1188287646 X:28347710-28347732 CGGAAGGAGGGAGGGGAAATAGG - Intergenic
1188658088 X:32723515-32723537 TGGAAGAAATGAGGAGAAGTAGG + Intronic
1189247024 X:39571261-39571283 CTGTAGGAATGAGGACATATGGG - Intergenic
1189639469 X:43052058-43052080 ATGAAGGATTGAGGAGACATTGG - Intergenic
1191188999 X:57645729-57645751 CTGAAAGAATGTGGAGAAAATGG + Intergenic
1191765179 X:64690600-64690622 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1192176575 X:68889943-68889965 ATGAAGGAATGCAGAGAAATGGG + Intergenic
1192372660 X:70527745-70527767 CTGAAGCATTAAGGGGAAATGGG + Intergenic
1192429522 X:71102917-71102939 TTGAAGGAATGAGGGGACCTGGG - Exonic
1192897929 X:75463793-75463815 CAGGAGGGATGTGGAGAAATAGG + Intronic
1194993072 X:100565812-100565834 TGGAAAGAATGTGGAGAAATTGG + Intergenic
1195131492 X:101858382-101858404 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1195157463 X:102138396-102138418 CCAAAGTAATGAGGAGTAATGGG - Intergenic
1195295224 X:103469924-103469946 ATGAAGGAATGAGAAGAGACAGG + Intergenic
1195449775 X:104998397-104998419 TTGAAGGAAAGTAGAGAAATGGG + Intronic
1195596443 X:106696682-106696704 CTGAAGGAATGAAGAGGTAGGGG - Intronic
1195815029 X:108875527-108875549 CTGAAGGAGTGAGGACAAAAGGG + Intergenic
1196297362 X:114013858-114013880 CTGAATGAACAAGGAGAAAAGGG + Intergenic
1196370740 X:114977063-114977085 CTGGAGAGATGTGGAGAAATAGG + Intergenic
1196417501 X:115487171-115487193 CTGAGGGAATGGGGAGAATGAGG + Intergenic
1196933865 X:120709600-120709622 CTGGAAGAATGGGGAGAAGTTGG - Intergenic
1197105265 X:122706584-122706606 CCGGAGAAATGTGGAGAAATAGG + Intergenic
1197555559 X:127948226-127948248 GTGAAAAAATGAAGAGAAATAGG - Intergenic
1198285898 X:135191715-135191737 ATGGAGGAATGAGGAGATGTTGG + Intergenic
1198287222 X:135203035-135203057 ATGGAGGAATGAGGAGATGTTGG - Intergenic
1198502291 X:137263305-137263327 CTGTAGGAATGGAAAGAAATTGG + Intergenic
1198567814 X:137922902-137922924 TTGCAGGCAAGAGGAGAAATGGG + Intergenic
1198712290 X:139518229-139518251 ATGAAGGAATGAGAAGAGACAGG - Intergenic
1198852233 X:140977243-140977265 GTGAAGGGAAGAGGAGAAAAGGG - Intergenic
1198867020 X:141133928-141133950 GGGCAGGAGTGAGGAGAAATTGG + Intergenic
1199555324 X:149101814-149101836 CTGAAGGAAAGAGGAGACTGGGG + Intergenic
1199804956 X:151290145-151290167 CTGGAGGAATCAGGAGATATTGG - Intergenic
1200080771 X:153575346-153575368 TTGAAGGAAGGAGCAGAAGTGGG + Intronic
1200366021 X:155665233-155665255 TGGGAGAAATGAGGAGAAATAGG + Intronic
1200694984 Y:6350843-6350865 TAGAAGGACTGAGGAGAATTAGG - Intergenic
1200907752 Y:8501974-8501996 CTGAGAGGATGTGGAGAAATAGG - Intergenic
1201040293 Y:9823867-9823889 TAGAAGGACTGAGGAGAATTAGG + Intergenic
1201347482 Y:13000588-13000610 ATGAAGGAATGAGAAGAGATAGG + Intergenic