ID: 1148824575

View in Genome Browser
Species Human (GRCh38)
Location 17:50382987-50383009
Sequence CTCACTGCTGAGAGTCGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 2, 1: 1, 2: 0, 3: 4, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148824568_1148824575 18 Left 1148824568 17:50382946-50382968 CCAAACTCCAAGGCTGGGAGGCA 0: 1
1: 1
2: 2
3: 26
4: 274
Right 1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG 0: 2
1: 1
2: 0
3: 4
4: 80
1148824563_1148824575 28 Left 1148824563 17:50382936-50382958 CCATAGGAATCCAAACTCCAAGG 0: 1
1: 1
2: 2
3: 24
4: 172
Right 1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG 0: 2
1: 1
2: 0
3: 4
4: 80
1148824570_1148824575 11 Left 1148824570 17:50382953-50382975 CCAAGGCTGGGAGGCAGCAGGTG 0: 2
1: 0
2: 9
3: 81
4: 727
Right 1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG 0: 2
1: 1
2: 0
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148824575 Original CRISPR CTCACTGCTGAGAGTCGGTC TGG Exonic
900548032 1:3239404-3239426 CTCACTGCTGGGAGACTGTGGGG - Intronic
901002913 1:6157566-6157588 CTCAGTGCTGGGAGACGCTCAGG - Intronic
915562707 1:156696679-156696701 CTGGCTGCTGAGAGTCTTTCTGG - Intergenic
916738896 1:167631144-167631166 CTGCCTGCTGAGAGGAGGTCCGG + Intronic
922927761 1:229364593-229364615 CACACTTCTGAGATTCTGTCTGG + Intergenic
1062940992 10:1421309-1421331 CTCACAGCTGAGCGTGGGTGGGG - Intronic
1069842648 10:71349397-71349419 CTCACTGCCGAGACTGTGTCTGG - Intronic
1072590829 10:96827179-96827201 CTCACTGTTGAGGGTCAGGCAGG + Intergenic
1075634224 10:124019373-124019395 GTCACAGCTGAGAGTGGTTCTGG + Intronic
1078076729 11:8168956-8168978 CACAGTGCAGAGAGTCGCTCTGG - Exonic
1078541552 11:12217471-12217493 CCCACTGCTGACTGTCAGTCTGG + Intronic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1080569991 11:33547112-33547134 CCCTCTGCTGAGAGTGGGTGAGG + Intronic
1081383140 11:42441004-42441026 CACAGTGCTGAGATTGGGTCTGG - Intergenic
1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG + Intronic
1084126022 11:67099529-67099551 CTCACTTCTGTGAGTGTGTCTGG - Intergenic
1086145689 11:83548931-83548953 CTCTGTGCTGAGACTTGGTCTGG - Intronic
1086606194 11:88699490-88699512 CTCACAGCTGAGTCTCTGTCTGG + Intronic
1095169542 12:39018587-39018609 GTCACTGGTAAGAGTCTGTCTGG + Intergenic
1107482353 13:40795196-40795218 CTCGCTGGTGAGAGGCGGCCTGG - Intronic
1127962700 15:63901622-63901644 ACCACTGCTGAGAGTCGGAGAGG + Intergenic
1137563613 16:49519427-49519449 CACAATGCTGAGAGTTGGTGAGG - Intronic
1138722284 16:59096531-59096553 CTCACTGGGGAGTGTCGGACAGG + Intergenic
1140754555 16:78055823-78055845 CTCACTGTTGAGAGTCGGTCTGG + Intronic
1148644155 17:49209775-49209797 CTCCCAGCTGAGAGTTGGACTGG - Intronic
1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG + Exonic
1149984995 17:61340605-61340627 CTCCCTGCTGTGAGTCGCTGCGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152568547 17:81111203-81111225 CTCACTGCTGGGTGTGGCTCTGG + Intronic
1154962752 18:21326513-21326535 ATTACTGCTGAGAGTCGGGGAGG - Intronic
1157814532 18:50721254-50721276 CTGACTGCTGGGAATCGGTGAGG - Intronic
1159534492 18:69698540-69698562 CTCACTGAGGAGATACGGTCGGG + Exonic
1161907632 19:7168968-7168990 CTCACTGTTTAGAATCTGTCAGG + Intronic
1162154982 19:8671504-8671526 CTGACTGCTCAGAGTCACTCTGG + Intergenic
1162464024 19:10830167-10830189 CTCACTGCTGGGGGCCGGCCAGG - Exonic
1167430812 19:49453415-49453437 CGCACTGGTGAGAGTCTGCCCGG + Exonic
925377499 2:3398706-3398728 CTCACGGCTGACAGGCGGTTAGG - Intronic
925690972 2:6522711-6522733 CTCACTGCTGAGAGCCTCCCGGG - Intergenic
933896900 2:86819580-86819602 CCCACTGTTGAGACTCGCTCAGG + Intronic
935090741 2:99892711-99892733 CCCACTGCTGAGAATGGCTCAGG + Intronic
935740543 2:106143724-106143746 CTCCCTGCTGAGAGCCTGTAAGG - Intronic
937087591 2:119181578-119181600 CTCACTGCTGGGCCTCGGCCTGG + Intergenic
940784612 2:157968125-157968147 CTCACTGCTGGGGGCCGGTGGGG + Intronic
941178036 2:162223865-162223887 ATCACTGCTGAGATTAGTTCTGG - Intronic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
1175267771 20:57712962-57712984 CTCACTGCTGGGAGTGGGAGTGG + Intergenic
1180756272 22:18164093-18164115 CTCTCTGCTTAGAGACGGACAGG + Intronic
1181413201 22:22739343-22739365 CAGACTGCAGAGAGTAGGTCAGG + Intronic
1184962941 22:47944800-47944822 CTTACTGCTGTGATTCAGTCCGG + Intergenic
952119536 3:30225737-30225759 CTCACTCCAGAGAGTCAGCCTGG - Intergenic
952766086 3:36955528-36955550 CAAACTGCTGAGAGATGGTCTGG - Intergenic
955930541 3:64052067-64052089 CTCACTGGTGAGGGTGGGTGTGG + Intergenic
963743015 3:149098104-149098126 CTCACTGCCCAGGGTCGGTGGGG + Intergenic
969429278 4:7144863-7144885 CTCACAGGTGAGAGGCCGTCAGG - Intergenic
977745787 4:100545560-100545582 CTAACAGCTGAGAGTCTGTCAGG + Intronic
982042272 4:151408539-151408561 CCCACTGCAGGGAGTCTGTCAGG + Intergenic
982250069 4:153396279-153396301 CTCACTGCTGAGATTCTGCTGGG + Intronic
985696668 5:1344868-1344890 CTCGCGGCTGAGAGGCGGGCGGG - Exonic
990540896 5:56771535-56771557 CTCACTGTTGAGGGCCGGGCAGG + Intergenic
992337887 5:75792191-75792213 CTCAGTTTTGAGAGTCGGACTGG - Intergenic
999325159 5:150639267-150639289 CTCTCTGCTGGCAGTGGGTCGGG - Intronic
1009418911 6:63443561-63443583 CTCACTGCTGAGAGTCGGTCTGG - Intergenic
1009738891 6:67718193-67718215 TTCACTACTGAGAGTGGGGCTGG + Intergenic
1011762843 6:90586960-90586982 CTCCAGGCTGAGGGTCGGTCCGG - Exonic
1017491499 6:154949766-154949788 ATCACTGCTGAGAGTGTGTTGGG + Intronic
1019102977 6:169647079-169647101 CTCACTTCTGAGAGGCGTTCAGG + Intronic
1019168925 6:170117711-170117733 GTCACTGCGGAGAGGGGGTCAGG - Intergenic
1021901031 7:25285787-25285809 CTCACTACCCAGAGTTGGTCAGG - Intergenic
1029473168 7:100767230-100767252 CTCACTGCTCAGAGGCTGTAAGG + Exonic
1029883783 7:103845474-103845496 CACAATGTTGAGAGTGGGTCGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033600631 7:142886009-142886031 CTCACTGCCTAGAGTCTCTCAGG - Intergenic
1035590932 8:812423-812445 GTCAATGCTGAGAGTCTGGCGGG - Intergenic
1038847607 8:31244360-31244382 CTCACTGCCCAGGGCCGGTCGGG + Intergenic
1043201954 8:77381448-77381470 CTCATTGCTGACAGTGGGGCTGG - Intergenic
1048693012 8:136989270-136989292 CTCTCTGCTGAGAGTTGGGCAGG - Intergenic
1050023342 9:1307929-1307951 CTCACTACTGAGAGTTTGACAGG - Intergenic
1052717476 9:32134440-32134462 CTCACTGCTGGGATTCAGGCAGG + Intergenic
1055391407 9:75825934-75825956 GTCAATGCTGAGAGTCAGGCTGG + Intergenic
1058816762 9:108691570-108691592 CTCACTGCTGGGAGTGTGTTAGG + Intergenic
1058907352 9:109492441-109492463 TTCAGTGCTGAGAGTCGCTGTGG - Intronic
1061452942 9:130678415-130678437 CTCAGGGCTGAGACTGGGTCCGG + Intronic
1061498628 9:130989969-130989991 CCCACTGCACAGAGTCGGACGGG + Intergenic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1188807456 X:34609171-34609193 CTCACTGCTCAGAGCCATTCAGG - Intergenic
1189030575 X:37445299-37445321 CTTACTGCTCAAAGTTGGTCTGG + Intronic
1200178830 X:154137804-154137826 CTCCCAGCTGAGAGTCCATCTGG + Intergenic