ID: 1148825775

View in Genome Browser
Species Human (GRCh38)
Location 17:50392852-50392874
Sequence TACTCAGGTCTAGCTTCACC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148825772_1148825775 19 Left 1148825772 17:50392810-50392832 CCAGACGGCCAAAGTCTGCTGGC 0: 1
1: 0
2: 1
3: 6
4: 69
Right 1148825775 17:50392852-50392874 TACTCAGGTCTAGCTTCACCAGG 0: 1
1: 0
2: 1
3: 4
4: 72
1148825773_1148825775 11 Left 1148825773 17:50392818-50392840 CCAAAGTCTGCTGGCAGCTGCTG 0: 1
1: 1
2: 3
3: 26
4: 292
Right 1148825775 17:50392852-50392874 TACTCAGGTCTAGCTTCACCAGG 0: 1
1: 0
2: 1
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148825775 Original CRISPR TACTCAGGTCTAGCTTCACC AGG Exonic
908015941 1:59836155-59836177 TACTTAGGTTTAGTTTTACCAGG + Intronic
919834297 1:201563182-201563204 GACTCAGGGCTAGCTGCCCCTGG + Intergenic
919869940 1:201812663-201812685 TACTGGGGTCCAGCTTCCCCCGG + Intronic
1066387128 10:34950592-34950614 TATTCAGATCTAACTTCACATGG + Intergenic
1067432112 10:46251628-46251650 TACTGAGCTCCAGCTTCCCCTGG - Intergenic
1067441118 10:46309713-46309735 TACTGAGCTCCAGCTTCCCCTGG + Intronic
1068232781 10:54192307-54192329 TACTCAAGTCTATCTTCTGCAGG - Intronic
1075420653 10:122298138-122298160 TTGTGAGGTCTAGATTCACCTGG + Intronic
1075507081 10:123033264-123033286 TACTCTGCTCTGGATTCACCCGG - Intronic
1083084721 11:60130847-60130869 CACTCAGGTCTAACTTCTCCAGG - Intergenic
1086756204 11:90565850-90565872 TACTCAGCTCTTGCTTTATCTGG + Intergenic
1086966380 11:93032273-93032295 CACCCAGGTCTACCTTCTCCAGG - Intergenic
1088432629 11:109775675-109775697 AACTCATGTCTTGCTTCTCCTGG - Intergenic
1089740058 11:120576384-120576406 TCCTGAAGTCTAGCGTCACCTGG - Intronic
1092584506 12:9883416-9883438 TACTCAGCTCTCTGTTCACCTGG + Intronic
1094733375 12:33203754-33203776 TACGCAGGTCTCGCCACACCTGG - Intergenic
1097696559 12:62780651-62780673 TACTGTGGTTAAGCTTCACCTGG + Intronic
1102107145 12:110335239-110335261 TACTGAGGTCTAGGCTCCCCGGG - Intronic
1107989822 13:45810008-45810030 GACTCAGGACTAGCTCGACCAGG - Intronic
1108411909 13:50158029-50158051 TAATTTTGTCTAGCTTCACCTGG + Intronic
1113636148 13:111920391-111920413 TGCCCAGGTCTAGTTTCAGCAGG - Intergenic
1115324117 14:32117746-32117768 TATTCAGTTCTAGCTTGACATGG + Intronic
1116480104 14:45386927-45386949 TGCTCAAGTCTAGCTTGACAGGG - Intergenic
1125953856 15:43776275-43776297 AACTCAGGCCCAGCTGCACCTGG - Intronic
1128790447 15:70429675-70429697 TACACCTTTCTAGCTTCACCTGG + Intergenic
1132641080 16:978877-978899 CACTCTGCTCTAGCTTCCCCAGG + Intronic
1135894076 16:26382779-26382801 TCCCCAGGGCTAGCTTCCCCTGG - Intergenic
1136245945 16:28975762-28975784 AACCCAGGTCTGTCTTCACCTGG - Intronic
1142486510 17:251013-251035 TACTAAGGTCTAGTTTCTCTAGG - Intronic
1143616897 17:8057067-8057089 CGCTCAGGTGTAACTTCACCTGG - Intergenic
1148825775 17:50392852-50392874 TACTCAGGTCTAGCTTCACCAGG + Exonic
1150712243 17:67541737-67541759 CACTCAAGTCTAGCTTTTCCGGG - Intronic
1163614858 19:18320941-18320963 TTCTCAGGTCTAGATCCACGAGG + Intronic
925203483 2:1987754-1987776 AACTGAGGTCTGGCTTCTCCAGG - Intronic
930051491 2:47219464-47219486 TAGTCATGTCCAGCTTCGCCAGG - Intergenic
933185916 2:79279224-79279246 TACTTAGGTCTCTCTTCAGCAGG - Intronic
934056777 2:88257999-88258021 TCCTCAGTTCTAGCGTCAGCAGG + Intergenic
935948641 2:108308942-108308964 TCCTCAGGGCTGGCTGCACCAGG - Exonic
936781659 2:116040228-116040250 TACTGAGGTCTACCTTGTCCTGG + Intergenic
941000555 2:160198393-160198415 TACTCAGCTCTTGCTGCACTTGG + Intronic
943961015 2:194264072-194264094 TACTCAGATTTATCTTCACTTGG - Intergenic
1169169511 20:3453342-3453364 AACTGAAGTCTAGCTTCAGCCGG + Intergenic
1175656758 20:60777528-60777550 TACTAAGTTCTAGCTACACAGGG - Intergenic
1176601790 21:8800977-8800999 TACACAAGTCTATATTCACCTGG + Intergenic
1177630266 21:23717911-23717933 AACTCAGGTGTAGCTTAACAGGG - Intergenic
1180232920 21:46438253-46438275 TGCTCAGCTCCAGCTTCTCCTGG - Exonic
1184521017 22:44994141-44994163 TAGGCAGGGCTAGCTTCAGCTGG + Intronic
952622534 3:35362802-35362824 TACTCAGTGCTAGCTCCACGTGG + Intergenic
957560651 3:81816428-81816450 TAGTCAGGGCTATCTTCTCCTGG + Intergenic
963842200 3:150119186-150119208 GACTCAGGTATAGCATCACATGG + Intergenic
968961753 4:3749085-3749107 CACTCTGGTCTGGCTTCCCCAGG - Intergenic
971471384 4:27030671-27030693 TTCTCATGTTTAGCTTTACCTGG + Intergenic
978196538 4:105978916-105978938 TACTCAGGTCTGGCTTTTCTGGG - Intronic
978756642 4:112309699-112309721 TACTGAAGTTTAGCTTCATCTGG - Intronic
982429608 4:155307603-155307625 TAATAAGGTCTCTCTTCACCTGG + Intergenic
984278920 4:177643741-177643763 TACCCAGGTCTATTTTCCCCTGG + Intergenic
987404128 5:17507648-17507670 AACTCAGGGCTGGCTTCACGGGG - Intergenic
988941579 5:36152780-36152802 TACTCAGGTCTGGAATCTCCTGG - Exonic
989120301 5:37998186-37998208 TACTCATGTCTGACTTCACCTGG + Intergenic
993085790 5:83362153-83362175 TAATCAGGTCTTGCTTTGCCTGG - Intergenic
997263369 5:132480405-132480427 TTCTCAAGAATAGCTTCACCTGG - Intergenic
997383009 5:133450868-133450890 TACTAAGGGCTGGCATCACCTGG - Intronic
1006047047 6:31307488-31307510 TACTTGGGTCTAGCTTCACCGGG - Intronic
1006989357 6:38200013-38200035 ACCTCAGGTCTGGCTTCACTGGG - Intronic
1009418551 6:63441260-63441282 TTCTAAGGTCTAGCTTCGCCAGG - Intergenic
1012790923 6:103695069-103695091 TTCTCAATTCTAGATTCACCTGG - Intergenic
1019732792 7:2637054-2637076 TCCCCAGTTCTAGCATCACCAGG + Intronic
1019857051 7:3619868-3619890 GACTGAGGTGTAGATTCACCTGG + Intronic
1021762580 7:23915603-23915625 TACTCAGCTCTAGCTTTTCATGG + Intergenic
1037347531 8:17915789-17915811 TGCTCAGGTGTAACTCCACCTGG + Intergenic
1038477716 8:27879790-27879812 TACCCAGCTCTAGATACACCAGG + Intronic
1046791079 8:118322608-118322630 TATTCAGGTCTAGCTTTACTTGG - Intronic
1052423029 9:28268388-28268410 AACTCTGTTCTAGGTTCACCAGG - Intronic
1055833856 9:80415989-80416011 TTTTCAGGACTAGCTTCAACAGG + Intergenic
1061139101 9:128753576-128753598 TAGTCAGGTACAGCTCCACCAGG + Exonic
1188851414 X:35137169-35137191 TAATCAGGTCTCACATCACCAGG - Intergenic
1189291297 X:39887764-39887786 TGCTCAGGTCTGGCTCCAGCTGG - Intergenic
1192214043 X:69145574-69145596 AACTCAGCTGAAGCTTCACCTGG + Intergenic