ID: 1148826647

View in Genome Browser
Species Human (GRCh38)
Location 17:50398805-50398827
Sequence TTATCTCAGAGGGGCCGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148826641_1148826647 14 Left 1148826641 17:50398768-50398790 CCTCAGTTTACTCATTTTGAAAT No data
Right 1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG No data
1148826639_1148826647 24 Left 1148826639 17:50398758-50398780 CCACTCCAAACCTCAGTTTACTC No data
Right 1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG No data
1148826640_1148826647 19 Left 1148826640 17:50398763-50398785 CCAAACCTCAGTTTACTCATTTT No data
Right 1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG No data
1148826638_1148826647 25 Left 1148826638 17:50398757-50398779 CCCACTCCAAACCTCAGTTTACT No data
Right 1148826647 17:50398805-50398827 TTATCTCAGAGGGGCCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148826647 Original CRISPR TTATCTCAGAGGGGCCGAGC AGG Intergenic
No off target data available for this crispr