ID: 1148826730

View in Genome Browser
Species Human (GRCh38)
Location 17:50399327-50399349
Sequence CAGCAAACAGCAGTAGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148826726_1148826730 13 Left 1148826726 17:50399291-50399313 CCAGAGGGGTGGAAGTCAGCAGC No data
Right 1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG No data
1148826725_1148826730 19 Left 1148826725 17:50399285-50399307 CCAGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG No data
1148826722_1148826730 24 Left 1148826722 17:50399280-50399302 CCCTGCCAGATCCAGAGGGGTGG 0: 10
1: 46
2: 99
3: 132
4: 299
Right 1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG No data
1148826724_1148826730 23 Left 1148826724 17:50399281-50399303 CCTGCCAGATCCAGAGGGGTGGA 0: 10
1: 48
2: 85
3: 148
4: 393
Right 1148826730 17:50399327-50399349 CAGCAAACAGCAGTAGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148826730 Original CRISPR CAGCAAACAGCAGTAGTGGA CGG Intergenic
No off target data available for this crispr