ID: 1148830825

View in Genome Browser
Species Human (GRCh38)
Location 17:50429908-50429930
Sequence CCTTCCCCAAAGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 264}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148830819_1148830825 -7 Left 1148830819 17:50429892-50429914 CCCTATCTATGTGCCTCCTTCCC 0: 1
1: 0
2: 0
3: 31
4: 331
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830813_1148830825 21 Left 1148830813 17:50429864-50429886 CCAGAACTCCTCACGACCAACTC 0: 1
1: 0
2: 0
3: 4
4: 103
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830818_1148830825 -6 Left 1148830818 17:50429891-50429913 CCCCTATCTATGTGCCTCCTTCC 0: 1
1: 0
2: 1
3: 27
4: 275
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830814_1148830825 13 Left 1148830814 17:50429872-50429894 CCTCACGACCAACTCCTTCCCCC 0: 1
1: 0
2: 2
3: 26
4: 333
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830816_1148830825 -1 Left 1148830816 17:50429886-50429908 CCTTCCCCCTATCTATGTGCCTC 0: 1
1: 0
2: 0
3: 28
4: 354
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830815_1148830825 5 Left 1148830815 17:50429880-50429902 CCAACTCCTTCCCCCTATCTATG 0: 1
1: 0
2: 1
3: 25
4: 270
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830820_1148830825 -8 Left 1148830820 17:50429893-50429915 CCTATCTATGTGCCTCCTTCCCC 0: 1
1: 0
2: 3
3: 24
4: 333
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264
1148830817_1148830825 -5 Left 1148830817 17:50429890-50429912 CCCCCTATCTATGTGCCTCCTTC 0: 1
1: 0
2: 2
3: 19
4: 285
Right 1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG 0: 1
1: 0
2: 2
3: 23
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148830825 Original CRISPR CCTTCCCCAAAGAAGGTGGA TGG Intronic
900359323 1:2280424-2280446 CCTTCCCCAACGAGGGTAGAAGG - Intronic
900489405 1:2939415-2939437 CCATCCCCACAGATGGGGGAAGG + Intergenic
901004073 1:6163278-6163300 CTTTCCCCAGTGCAGGTGGATGG - Intronic
902048877 1:13546260-13546282 GCTTCCCCAAAGCAGGTGATGGG + Intergenic
902648536 1:17821080-17821102 ACTTCACCAAAGAAGATAGATGG - Intronic
903323390 1:22555739-22555761 CCTTCCCCATAGAAGTCTGAGGG + Intergenic
904574758 1:31498098-31498120 CAATCACCAAAGAAGGTGAAGGG - Intergenic
904970502 1:34415907-34415929 CCTTCCCAACATAGGGTGGAAGG + Intergenic
906138920 1:43521747-43521769 CCCTCACCAAAAATGGTGGAAGG - Intergenic
906248509 1:44293761-44293783 CCTTCCTCAAAGAAGCTGTGTGG - Intronic
907448599 1:54527099-54527121 TCTTCTCCAAAGAAATTGGATGG + Intergenic
907726433 1:57024865-57024887 CTGTCCCCAAAGAAGCTGGATGG - Intronic
908113508 1:60919793-60919815 CCTTCTTGAAAGGAGGTGGAAGG + Intronic
910792340 1:91064448-91064470 TCTTTCCCAAAGAAAGTTGAGGG - Intergenic
913957757 1:143320084-143320106 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914052067 1:144145448-144145470 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914127130 1:144821093-144821115 CCTACCCCAGAGAAGGGGTATGG - Intergenic
915253770 1:154609597-154609619 CCTTCCCCACAGCAGGTAGGGGG + Intronic
916158329 1:161881039-161881061 CCTTCACCAAAGAAGATTTATGG - Intronic
917642812 1:176999213-176999235 CCTTCTCCAGAGAAAGAGGATGG + Intronic
918858960 1:189796728-189796750 CCTCCCCCAAAAAATGGGGAGGG - Intergenic
921250314 1:213291253-213291275 CCTCACACAAAGAAGTTGGAAGG - Intergenic
921605387 1:217146772-217146794 CCTAATCCAAAGAAGGTGAAAGG + Intergenic
922893530 1:229080967-229080989 ACCTCACCAAAGAAGGTGTATGG - Intergenic
923034124 1:230272289-230272311 CCTTCCCCAGAGAAGGTGGCCGG + Intronic
924667212 1:246085466-246085488 CCTTCCCCGAAGCAGGTCAAAGG + Intronic
1063006730 10:1978887-1978909 CCATCCCCAAAGAGGATGTAAGG - Intergenic
1064057799 10:12112359-12112381 CCTTCCCCAAAGGCAGTGAAAGG - Intronic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1066759917 10:38740515-38740537 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1066961700 10:42232254-42232276 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1067073032 10:43150803-43150825 GAGTCCCCAAAGAAGGGGGAAGG - Intronic
1067724850 10:48762330-48762352 CATTCCCCAAAGAAGGGACATGG - Intronic
1067814145 10:49459292-49459314 CCTTCCCCAAAGGCTGTGAAGGG + Intronic
1069571275 10:69495790-69495812 CCATTCCCAAAGCAGGTGGCTGG + Intronic
1070576628 10:77684069-77684091 CCTTCCCCCAAAAGGCTGGAGGG + Intergenic
1071305620 10:84296531-84296553 CCTTTGCCAAAGAATGTGGGTGG + Intergenic
1072195694 10:93115882-93115904 CCAAACCCAAAGAAGGTGGCTGG + Intergenic
1074085879 10:110208746-110208768 CCCCCCCCAAAGAAGGAGGCCGG + Intronic
1074438110 10:113451881-113451903 CCATCCCCAGAGATGGTGAATGG + Intergenic
1075086646 10:119418328-119418350 CCTTCACCAAAGAAGTGGGTGGG + Intronic
1075467735 10:122664181-122664203 CATCCCACAAAGAATGTGGATGG - Intergenic
1075517072 10:123117915-123117937 CATTCCACAAATAGGGTGGAGGG + Intergenic
1075604814 10:123796953-123796975 ACATCTCCAAAGAAGGTGGCTGG - Intronic
1078935021 11:15942322-15942344 AAGTCCCCAAGGAAGGTGGAGGG + Intergenic
1080752127 11:35160302-35160324 CCTGCCCCATCGAAGCTGGAGGG - Intronic
1083353564 11:62048337-62048359 CCTTCCCCTAGGAAGAGGGAGGG - Intergenic
1083355421 11:62062680-62062702 CCTTCCCCTAGGAAGAGGGAGGG - Intergenic
1084013662 11:66366388-66366410 TCTTCCCCAAAGATGGTGGTTGG + Intronic
1085043460 11:73340308-73340330 CCTGCCCCCAAGAAGGGGGCGGG - Intronic
1085521802 11:77143532-77143554 CCTGCCCCGGAGAAGGTGGCTGG + Intronic
1085789325 11:79483378-79483400 CTTACCACAAAGAAGGAGGAAGG + Intergenic
1089775617 11:120833492-120833514 CCTTCCACAAGGGTGGTGGAGGG - Intronic
1089956281 11:122574367-122574389 CCTGCCCCAGAGCAGGAGGATGG - Intergenic
1090083166 11:123627922-123627944 CCCTCCCGTGAGAAGGTGGATGG - Intergenic
1094542075 12:31370972-31370994 CCTTCCCCCATGAGGGTGAAGGG + Intergenic
1096577373 12:52561380-52561402 CCTTCCCCAGGGCAGGAGGATGG + Intergenic
1101245947 12:102884582-102884604 CCCACCCCAAAGAAGGAGGCAGG - Intronic
1102924798 12:116818666-116818688 CCTTCCCCAGAAAAAGAGGAAGG - Intronic
1103272131 12:119682036-119682058 CCCTCCTCCAAAAAGGTGGAAGG + Intergenic
1103342386 12:120228032-120228054 CATACCCCAAAGAAGGTGTCAGG + Intronic
1104130468 12:125888779-125888801 CCTACCCCAAAGAAGGTTGAGGG + Intergenic
1105826045 13:24124488-24124510 CTTTCTCGAAGGAAGGTGGATGG + Intronic
1106978090 13:35246670-35246692 CCTGCTCCAATGAAGGTGGCAGG + Intronic
1107274085 13:38657171-38657193 CCATTCCCAAAGAAGGATGAGGG - Intergenic
1107283240 13:38760457-38760479 CCATCCACAAAGGAAGTGGAAGG + Intronic
1107354247 13:39549111-39549133 GCTTCATCAAAGAAGATGGATGG + Intronic
1108393289 13:49969318-49969340 TCTTCCCCAAAGAAGATGTATGG + Intergenic
1109261391 13:60149177-60149199 CCTTCCTGACAGAATGTGGATGG + Intronic
1109624202 13:64954049-64954071 CCTTCCTCAAAGGAAGAGGATGG + Intergenic
1112720243 13:102236140-102236162 CATTCCCCAAAGCAAGAGGAGGG - Intronic
1113536019 13:111066860-111066882 CCTTCCCCAGAGCTCGTGGAAGG - Intergenic
1114689402 14:24566341-24566363 CCTTCCCCAAGGAAGCAGTATGG - Intergenic
1116479971 14:45385622-45385644 CCTTTCCAAAAGAAGGGAGATGG + Intergenic
1116560178 14:46368575-46368597 CCTTCCCCAAGGAAGGGGTGAGG - Intergenic
1116918573 14:50548939-50548961 CCTACCCCATAAAAGGTGGGTGG + Intronic
1117733349 14:58745799-58745821 CCATCCCCAAAGCGGGTGAAGGG + Intergenic
1118593603 14:67419531-67419553 CCTTCCCCAAAGAAAGCAGGGGG + Intergenic
1118895033 14:69938727-69938749 TGTTCCCCAAAGGAGGTGAATGG - Intronic
1119370317 14:74135030-74135052 CCTACCTCAAAGAAGGTTCAGGG - Intronic
1119474489 14:74919254-74919276 CTTTCCCCAAAGTAGGTGCTTGG - Intronic
1122053425 14:99075613-99075635 CCTTCCCCAGGGAAGGTGCCTGG + Intergenic
1122271804 14:100571634-100571656 GCCTCCCCAGACAAGGTGGAGGG + Intronic
1122471171 14:101967412-101967434 ACTTCCACAAAAAAAGTGGAAGG - Intronic
1202930628 14_KI270725v1_random:30006-30028 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123421729 15:20141411-20141433 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123443333 15:20305125-20305147 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123530955 15:21147951-21147973 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123984646 15:25634450-25634472 CCTTCCCCCAAGAAAGGGGAGGG + Intergenic
1124178336 15:27448280-27448302 CCTTTCCCAATGGACGTGGAGGG + Intronic
1124420083 15:29513491-29513513 CCCTCCACGGAGAAGGTGGAGGG - Intronic
1127386935 15:58474560-58474582 CCTACATCAAAGATGGTGGAGGG - Intronic
1129241873 15:74256753-74256775 CCTTCCCAGAAGAGGGTAGAAGG + Intronic
1130662269 15:85840161-85840183 CCCTCCACGAAGAAGCTGGAAGG + Intergenic
1131406878 15:92172144-92172166 CCATCCCCAGAGGAGGTAGAGGG - Intronic
1132157071 15:99503126-99503148 CCTCCCCCCAAGCAGATGGATGG - Intergenic
1136722886 16:32338762-32338784 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136841207 16:33544761-33544783 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136863114 16:33714246-33714268 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1138110565 16:54320534-54320556 CTGTCCCCAGAGAAGATGGAAGG + Intergenic
1139307773 16:66002283-66002305 CCTTCCTAATAGAAGGTGGAAGG + Intergenic
1140188357 16:72794256-72794278 CCTTCCTCCATTAAGGTGGAAGG - Exonic
1140240128 16:73192766-73192788 CCGTCCTCAGAGAAGGTGGAAGG + Intergenic
1140887588 16:79258620-79258642 CCTTCCCCAAAGCCTGTTGAGGG - Intergenic
1203003545 16_KI270728v1_random:179002-179024 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203124600 16_KI270728v1_random:1562399-1562421 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203135153 16_KI270728v1_random:1715409-1715431 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203151372 16_KI270728v1_random:1845058-1845080 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1143345427 17:6245468-6245490 CCTTCCCCTAGGATGCTGGAAGG + Intergenic
1146957763 17:36946724-36946746 CCTTCTCCAGAGAAGGCGGAGGG - Intergenic
1147161439 17:38571607-38571629 CCTTCCCAAAAGACAGTGAAAGG + Intronic
1148288184 17:46415391-46415413 CCATCTCAAAAAAAGGTGGATGG - Intergenic
1148439660 17:47705181-47705203 CGTCCCCCAAAGAAGCGGGAAGG - Intronic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1149722086 17:58855333-58855355 CCTTCCCCAACTAAGGGGTAAGG + Intronic
1150249578 17:63698518-63698540 CCTTCCGCAGAGGGGGTGGAAGG + Exonic
1150494961 17:65600642-65600664 CCTTAACCAAAGGAGGGGGAAGG - Intronic
1154009751 18:10564653-10564675 TCATCCCCAAAGTAGGTGAAGGG - Intergenic
1155137998 18:23015718-23015740 CTTTCCCCAATGAAGGTGCGTGG + Intronic
1155385695 18:25274965-25274987 TCATCCCCAAAGCGGGTGGAGGG + Intronic
1156031488 18:32718422-32718444 CCTACCTCACAGAAGGTGCATGG - Intronic
1156471513 18:37379957-37379979 CCTTCCACTCAGAGGGTGGATGG + Intronic
1157081526 18:44530494-44530516 CCTTCCCCACAGAATTTGAATGG + Intergenic
1157396148 18:47343271-47343293 CCTTCCCCAGAGGATGAGGATGG + Intergenic
1157602949 18:48905407-48905429 CCCACCCAATAGAAGGTGGAGGG + Intergenic
1158905018 18:62003393-62003415 CCTTACAAAAAGGAGGTGGAGGG - Intergenic
1159591502 18:70340057-70340079 CCTGAGCCAAAGAATGTGGATGG - Intronic
1159821276 18:73147803-73147825 GTATCCCCAAAGAAGGTGGAGGG - Intergenic
1161949789 19:7461543-7461565 CCTTCTCAAAAGAAGAAGGAAGG + Intronic
1162273717 19:9636854-9636876 CCTTTCCCAAAGATTGAGGATGG + Intronic
1163049522 19:14671645-14671667 CCTTCCCCCAAGAAGATGCCAGG + Intronic
1163810743 19:19429872-19429894 TCTTCCCCACAGAGGGTTGATGG + Intronic
1166669974 19:44703936-44703958 CCTTCCCCCAACAAGGGGCATGG - Intronic
1166984681 19:46652746-46652768 CTGTCCCCACAGAAGGTTGAGGG + Exonic
1202691466 1_KI270712v1_random:97872-97894 CCTACCCCAGAGAAGGGGTATGG + Intergenic
925764491 2:7217823-7217845 GCTCCCCCAATTAAGGTGGATGG - Intergenic
928135122 2:28682270-28682292 CCTGCCCCAGAGTAGGTGGGGGG - Intergenic
929241517 2:39658317-39658339 CCCTCCCCAACCAAGGAGGAGGG - Intergenic
931450900 2:62366793-62366815 CCTTCTCCATAGAATATGGAAGG + Intergenic
931651391 2:64472020-64472042 CCTTGCCCCAGGAAGGTGGGTGG - Intergenic
931866283 2:66415070-66415092 CTTTCCTCTAAGTAGGTGGAAGG - Intergenic
933954925 2:87356078-87356100 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934274069 2:91564406-91564428 CCTACCCCAGAGAAGGGGTATGG + Intergenic
934323240 2:91984855-91984877 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934461554 2:94215646-94215668 CCTACCCCAGAGAAGGGGTATGG - Intergenic
936575966 2:113656008-113656030 ACTTCCCCAAAGAAGATATATGG + Intergenic
936682617 2:114791634-114791656 CTCTCCCCAATAAAGGTGGATGG - Intronic
937952993 2:127402510-127402532 CCTTCCCCATAAAAGGGGGTGGG - Intergenic
939086178 2:137721155-137721177 TCTTCCCAGAAAAAGGTGGAAGG - Intergenic
939374073 2:141341664-141341686 TCATCCCCAAAGAATGCGGATGG + Intronic
944646243 2:201783426-201783448 CCTTGGCCAAGGAGGGTGGAGGG + Intergenic
945415392 2:209564630-209564652 CCTTCCCCATAGATGGTGCTGGG + Intronic
946464894 2:219903155-219903177 CTTTATCCAATGAAGGTGGAAGG - Intergenic
947129668 2:226908441-226908463 CCTTCCTCAAAGAAGGTGTTAGG - Intronic
947439349 2:230104823-230104845 CCTTTCCCCATGAAGGTGAAAGG + Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
948318223 2:237046569-237046591 CCTTCCCCCAAGAATTCGGACGG + Intergenic
1169689876 20:8318569-8318591 CCTTCCACATAGAAGATGCACGG + Intronic
1171069069 20:22048799-22048821 CCTCCCCCACAGCAGATGGAAGG + Intergenic
1173837985 20:46138303-46138325 CCTGCCCCAGTGAAGGTGGCAGG + Intergenic
1175033880 20:55981534-55981556 CCTTCCCTGAAGAGGGTGGGAGG - Intergenic
1176065073 20:63190245-63190267 CCTTCTCCAAAGATGGTGGCAGG - Intergenic
1176592641 21:8658607-8658629 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1178498809 21:33109405-33109427 CCTTCCCCCAGGCAGGAGGAAGG + Intergenic
1179614133 21:42570830-42570852 ACTGCCCCCAAGCAGGTGGAGGG + Intronic
1180275497 22:10635749-10635771 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1180549985 22:16530726-16530748 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1180609578 22:17086332-17086354 ATTTACCGAAAGAAGGTGGAGGG + Intronic
1181354693 22:22291110-22291132 CCTACCCCACAGAAGGGGTATGG + Intergenic
1182351753 22:29703655-29703677 TCTTCCCCTCAGAAGGTGGTGGG + Intergenic
1182444344 22:30381304-30381326 CATTCCACAAAGATGGTGGGAGG - Intronic
1182465678 22:30514730-30514752 ACTTCCCCAAGGAAGGGAGATGG + Intergenic
1183614133 22:38932268-38932290 CATTCCTCATAGATGGTGGAAGG - Intergenic
1184234338 22:43175005-43175027 TCTGCCCCAGAGGAGGTGGAGGG + Intronic
1184525292 22:45019213-45019235 CCTTCCCGATAGAGGGTGGGAGG - Intergenic
1185424447 22:50757445-50757467 ACTTCCCCAAAGAAGATATATGG - Intergenic
949795328 3:7843672-7843694 ACTTCCCCAAAGAAGTTGAGAGG - Intergenic
950492502 3:13314569-13314591 CCTTGCCCAAAGAAGGAGATGGG + Intergenic
951979203 3:28547077-28547099 ACTTCCCCAAAGAAGATGTCAGG - Intergenic
952404990 3:32997549-32997571 GTTGCCCCAAAGAAGGTGGATGG - Intronic
953071939 3:39529651-39529673 CTTTCCCCGAAGGAGGTGGCAGG + Intergenic
953534841 3:43769741-43769763 CCTCCTCCAAGGAAGGCGGAAGG - Intergenic
954941049 3:54373659-54373681 CCTTCAGGAAATAAGGTGGAAGG + Intronic
960821215 3:121734560-121734582 ACTTCACCAAAGAAGATAGATGG + Intronic
961040458 3:123674662-123674684 ACTTCCCAAAGGAAGGTGCAGGG - Intronic
961449959 3:126998225-126998247 ACTTCACCAGAGAAGGTGGCTGG + Intronic
961576664 3:127842362-127842384 CCTTCCCCATCCAAGGTGGCAGG - Intergenic
961806127 3:129490620-129490642 CTTTCCACAAAGAAGATGGTTGG + Intronic
962042072 3:131717793-131717815 CATTCCCCATAAACGGTGGATGG - Intronic
962536992 3:136338805-136338827 AATTCCCCAAAGCAGGTAGATGG + Intronic
963049437 3:141128564-141128586 CAGCCCCCAGAGAAGGTGGAAGG + Intronic
963729313 3:148956232-148956254 CTGTCCCCAAAGAAGGGTGAAGG - Intergenic
965171154 3:165265875-165265897 CCGTCCCCAAAAAAGGAAGAAGG - Intergenic
968312544 3:197695971-197695993 CATTTCCCACAGAAGGTGGTCGG - Exonic
969071270 4:4541632-4541654 CCTTCCCCCAAAAAGCTGTAGGG + Intronic
969364621 4:6686935-6686957 CCTGGCCCAAAAAAGGTGGTTGG + Intergenic
969826506 4:9762412-9762434 GCCTCCCCAAAGATGGTGGGGGG - Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
971908552 4:32762604-32762626 CCTGCCACAAAGCAGGTAGAAGG + Intergenic
973722830 4:53742514-53742536 GATTCCCCAAAGAAGGTTTAGGG + Intronic
973895178 4:55405062-55405084 CTTTATTCAAAGAAGGTGGAGGG - Intronic
975056368 4:69936111-69936133 CCTTACACAAAGAAGGAGTAGGG + Intronic
975190879 4:71460685-71460707 CCTTCCCCAATGTAGATGAATGG + Intronic
976521128 4:86028256-86028278 CCTTCCTCAAAGAAGGTTAAGGG - Intronic
976727154 4:88225833-88225855 CCTTTCACAATGATGGTGGAGGG + Intronic
978634723 4:110790566-110790588 AGTTCCCCAAAGAAGGTGGTTGG + Intergenic
979434706 4:120674309-120674331 CCTTCCCCTAAGAATGGGGAAGG - Intergenic
981448977 4:144873749-144873771 TCTTCCTGAAAGAAGGTTGAGGG + Intergenic
983895244 4:173074491-173074513 TCTTCCCTAAAGCAGATGGATGG + Intergenic
987415422 5:17656458-17656480 TTTTCCCCTATGAAGGTGGAAGG + Intergenic
996166836 5:120234386-120234408 CCAACCCCAAAGACAGTGGAAGG - Intergenic
996282286 5:121745078-121745100 CCTTCCACAAAGAAGGCACAGGG - Intergenic
997188739 5:131909298-131909320 CCTTCCCCAAAGAATGTCCTTGG - Intronic
997732531 5:136191908-136191930 CCTTCCCGAAAGACGGCGGTCGG - Intergenic
998129899 5:139646499-139646521 GCTTCCCCAGAAAAGGTAGATGG + Intergenic
998227548 5:140338669-140338691 GCTTCCCCAGAGAAGGAGGGGGG + Intronic
999936322 5:156489755-156489777 CCTACACCAAAGAAAGTGGAAGG + Intronic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1004506675 6:16252539-16252561 ACTCCCTTAAAGAAGGTGGAGGG - Intronic
1005576702 6:27196467-27196489 GCATCCCAAAAGAAGGTGAATGG - Intergenic
1005805509 6:29470798-29470820 CCTTCCCCTAAAAAGGTGTTGGG - Intergenic
1006518462 6:34557420-34557442 CATTCCCCAGAGAAGGTTGAGGG + Intergenic
1007599921 6:43075416-43075438 CCTTCCCCCAAGCAGCTGGGAGG - Intergenic
1008201920 6:48601252-48601274 CCTTCACCAAATAAGAAGGAAGG - Intergenic
1009708991 6:67293078-67293100 CCTTCCCCATTCAAAGTGGAGGG + Intergenic
1014799433 6:125761306-125761328 CTTTCCACATAGAAAGTGGAAGG - Intergenic
1015400705 6:132785208-132785230 CCTTCCCCTAAGGGGATGGAGGG + Intronic
1016951828 6:149587802-149587824 CCTTCCCCAAGGTTGGGGGATGG + Intronic
1017066610 6:150534953-150534975 GCTGCCACAAAGCAGGTGGAGGG + Intergenic
1017684519 6:156898538-156898560 CCTGCCCCAAAGGACATGGAAGG - Intronic
1019428313 7:987554-987576 CCTACCCCAGAGGAGATGGAAGG - Intronic
1019988369 7:4674871-4674893 ACTTCTCCAAAGAAGGTATATGG - Intergenic
1023162805 7:37313685-37313707 TCTACCCCAAAGAAGGAGGGAGG - Intronic
1024969331 7:55054148-55054170 CCTTCCAGAAAGAAGGCGGGTGG - Intronic
1026416312 7:70184385-70184407 CCATTTCCAGAGAAGGTGGAGGG - Intronic
1026933757 7:74239872-74239894 CCTTCCCCATGGAAGGGGCATGG + Intronic
1027726629 7:81813747-81813769 CCTTCCCCATTCATGGTGGAAGG + Intergenic
1027890126 7:83962790-83962812 CCTTCCCCATTTAAGGAGGAAGG + Intronic
1031956595 7:127948712-127948734 CTTGCCCCAAAGAAGCTGGTAGG - Intronic
1033081879 7:138306341-138306363 CCCTCCCCAGAGTAGGGGGATGG + Intergenic
1033163252 7:139015889-139015911 CCATTCCCACAGGAGGTGGATGG + Intergenic
1033449587 7:141450545-141450567 CCTGCCCCAAGAATGGTGGATGG - Intronic
1035165805 7:156989066-156989088 CCTTCCCCAGAGCAGGAGGGAGG - Intergenic
1035933422 8:3809958-3809980 CCTGCAGCAAAGAAGTTGGAAGG - Intronic
1035986292 8:4435631-4435653 CCTTCCCCCAGGGAGGTGGTAGG - Intronic
1038382143 8:27106046-27106068 CCTTCCCCAGAGTAGGCCGAGGG - Intergenic
1038447102 8:27611789-27611811 CCTTCCCCAGAGATGGGGTAGGG + Intronic
1039276473 8:35938356-35938378 TCTTCCCCTAAGAAGGTGAAGGG - Intergenic
1039409991 8:37345403-37345425 CAGTCCCAAAAGAATGTGGAGGG + Intergenic
1039985157 8:42441099-42441121 ACTTCACCAAAGAAGATAGATGG - Intronic
1042772463 8:72394434-72394456 TCTTCCCCTAAGAAGGTGCAAGG - Intergenic
1043611622 8:82070244-82070266 CCTTCCCCAATGAAGATATAAGG - Intergenic
1043829348 8:84969441-84969463 CATTCCACTAAAAAGGTGGAAGG + Intergenic
1044319976 8:90791312-90791334 CCTTCCCCAAAGGCGGGGGCAGG - Intronic
1044729838 8:95220881-95220903 CCTTCCTCAGAGAAGGGGGCAGG - Intergenic
1045357796 8:101404811-101404833 GCTTCCCCAAGAAAGGTGAAGGG - Intergenic
1048859236 8:138711663-138711685 CCAGCCCCAGAGAAGGAGGATGG + Intronic
1050166009 9:2765314-2765336 CCTTCCCCAAAGAAAATAGATGG - Intronic
1051356773 9:16246671-16246693 CATTCCCCAAAGACTTTGGAGGG - Intronic
1052165624 9:25323432-25323454 CATTCACTAAAGAAGGTAGATGG + Intergenic
1052825046 9:33167915-33167937 CCTGCGGCAAAGAAAGTGGACGG + Intergenic
1053692030 9:40591299-40591321 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054272770 9:63046186-63046208 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1054303287 9:63392265-63392287 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054402066 9:64718775-64718797 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054435672 9:65203090-65203112 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054494721 9:65818597-65818619 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1055475864 9:76663404-76663426 CATTCCCTAAAGAAGGTGTCTGG - Intronic
1057535049 9:95893578-95893600 CCTTCCACAAAGAAAGTTAAGGG - Intronic
1057693957 9:97310674-97310696 CCTGCCCCAAAGAGGGTGAAAGG - Intronic
1060009769 9:120033188-120033210 CCCTCCCCCAGCAAGGTGGATGG - Intergenic
1060204245 9:121673247-121673269 CCAGCCCCAGAGAAGATGGAGGG - Intronic
1060543993 9:124450022-124450044 CCTTCCTCGCAGCAGGTGGAAGG + Intergenic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061723360 9:132567483-132567505 CCATACCCCAAGAAGGTGGCTGG - Intronic
1061747948 9:132753722-132753744 CCTTCCCTAGAGAACATGGAGGG - Intronic
1203622693 Un_KI270749v1:137435-137457 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1186355154 X:8783134-8783156 ACTTCCCGAAAGAAGGTCCACGG - Intergenic
1187542735 X:20214058-20214080 CTTTCCCCAAGAATGGTGGAAGG - Intronic
1189200288 X:39189507-39189529 CATAACCCAAAGAAGGGGGATGG - Intergenic
1190396159 X:49987370-49987392 CATTTCTCATAGAAGGTGGATGG + Intronic
1190808117 X:53859202-53859224 CCTTTCTCAAAAAAGGTGGGGGG - Intergenic
1192764051 X:74124753-74124775 CCTTTCCCAAAGATGAAGGATGG + Intergenic
1194724556 X:97379272-97379294 ACTTCCCCAAAAAGGGAGGAAGG + Intronic
1195317890 X:103696358-103696380 CCACCCCCAAAGAAGGGTGAAGG + Intergenic
1196679270 X:118454328-118454350 CTTTCCCTAATGAAGGTGCATGG - Intergenic
1197856392 X:130918012-130918034 CCTGCCTCACAGAAGTTGGAAGG - Intergenic
1199387523 X:147240500-147240522 CCTTCCACAATTATGGTGGAAGG + Intergenic
1201891356 Y:18947018-18947040 CCTTTCCCAAAGATTGAGGACGG + Intergenic