ID: 1148831721

View in Genome Browser
Species Human (GRCh38)
Location 17:50437100-50437122
Sequence CCCAAGAGGATGCAGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148831712_1148831721 17 Left 1148831712 17:50437060-50437082 CCACTAGCCTAGTGTCTGTGCAA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG 0: 1
1: 0
2: 2
3: 39
4: 272
1148831714_1148831721 10 Left 1148831714 17:50437067-50437089 CCTAGTGTCTGTGCAAATTAGGC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG 0: 1
1: 0
2: 2
3: 39
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148831721 Original CRISPR CCCAAGAGGATGCAGCCCCA TGG Intronic