ID: 1148831721

View in Genome Browser
Species Human (GRCh38)
Location 17:50437100-50437122
Sequence CCCAAGAGGATGCAGCCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148831714_1148831721 10 Left 1148831714 17:50437067-50437089 CCTAGTGTCTGTGCAAATTAGGC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG 0: 1
1: 0
2: 2
3: 39
4: 272
1148831712_1148831721 17 Left 1148831712 17:50437060-50437082 CCACTAGCCTAGTGTCTGTGCAA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG 0: 1
1: 0
2: 2
3: 39
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148831721 Original CRISPR CCCAAGAGGATGCAGCCCCA TGG Intronic
900386938 1:2414876-2414898 CTCAAGAGGAGGCTGCCACAGGG - Intergenic
900700630 1:4046750-4046772 TCCAAGAAGATGCAGCCTCTTGG + Intergenic
901144557 1:7056358-7056380 CACGAGAAGATGCAGCCCCCAGG + Intronic
901441586 1:9281528-9281550 CCCAAGGGATGGCAGCCCCAAGG + Intergenic
901693669 1:10990826-10990848 CCAAAGAGCCTGCCGCCCCAGGG - Intergenic
901817118 1:11800653-11800675 CCCAGGAGGCAGGAGCCCCAAGG - Intronic
902806729 1:18865644-18865666 CCCAAGAGGATCCTGACCCTAGG + Intronic
903780693 1:25818278-25818300 CCCAAGAGGGAGCCACCCCATGG - Intronic
904353923 1:29926406-29926428 CCCAAGAGGGACCAGCCCCCAGG - Intergenic
904865703 1:33577397-33577419 CCAAAGTGGATGGAGCCCCCGGG + Exonic
906190834 1:43898663-43898685 CCCTAGAGCAGGAAGCCCCAGGG + Intronic
907598921 1:55747080-55747102 CTCTGGAGGATGCAGCCACAAGG - Intergenic
910863053 1:91762124-91762146 CCAAAGGGGATGCAGCTCAAAGG + Intronic
911183816 1:94884183-94884205 CCCACCTGGCTGCAGCCCCAGGG + Intronic
911315580 1:96352965-96352987 CCCACGAGGAAGCAGCCACCAGG + Intergenic
911799711 1:102120973-102120995 CAGAACAGGATGCAGCCTCAGGG - Intergenic
916382044 1:164222537-164222559 CTCCAGAGAATGCAGCCACAAGG + Intergenic
917354437 1:174111533-174111555 CTCCAGAGGATGCAGCAACAAGG + Intergenic
917532922 1:175853149-175853171 CCCAAGAGGAGGCAGCTCCAGGG + Intergenic
919034182 1:192284535-192284557 CCCATGAGGGTGCAGCCCTGAGG - Intergenic
920519763 1:206614605-206614627 CCCCAGAGGATTCTGCACCATGG + Intergenic
922385362 1:225075993-225076015 CCCAAGTGGATCCAGGCCCTAGG - Intronic
922721723 1:227903240-227903262 GCCAAGAAGGTGCAGCCCCACGG + Intergenic
923564957 1:235069725-235069747 CCTCAGAGGAGGAAGCCCCATGG - Intergenic
923673421 1:236060834-236060856 CCCTTGAGGATGCAACACCAAGG + Intronic
1063041122 10:2338341-2338363 CCCTGGAGGATGCAGCAACAAGG - Intergenic
1063181041 10:3600500-3600522 CCCCAGAGGTTGCAGCCACCTGG - Intergenic
1063339745 10:5252237-5252259 TCCCAGAGGATGCAGGGCCAGGG + Intergenic
1063361764 10:5465178-5465200 CCCCAGAGGACGCAGCAACAAGG + Intergenic
1063397755 10:5707343-5707365 CCAAAGATGAGGCAGCCCCCAGG + Intronic
1065060379 10:21894878-21894900 CCCTAGAGGATGCAGCAACAAGG + Intronic
1065320317 10:24503025-24503047 CTCAGGAGGTTGCATCCCCATGG - Intronic
1066199194 10:33129035-33129057 CTCAAGAGGAGAGAGCCCCAAGG - Intergenic
1066415124 10:35214515-35214537 CTCATGAGGATTCAGCCCCTAGG + Intergenic
1067550715 10:47233743-47233765 CCCAGGAGCTAGCAGCCCCATGG + Intergenic
1067776649 10:49169145-49169167 CCCAAGTCCATGCAGCCCTAGGG - Intronic
1072058549 10:91786146-91786168 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1072421036 10:95290857-95290879 CCCACGAGGCGGAAGCCCCACGG + Exonic
1074618063 10:115090881-115090903 CTGAAGAACATGCAGCCCCACGG - Intergenic
1075563862 10:123488940-123488962 CTCCAGAGGATACAGCACCAAGG + Intergenic
1076707664 10:132310485-132310507 CCCAAGAGGATGCCAACCCCTGG + Intronic
1076737148 10:132463974-132463996 CCCCCGACGATGCAGCTCCAGGG - Intergenic
1077143756 11:1035911-1035933 CCCAGAAGGAGCCAGCCCCAAGG - Intronic
1077252410 11:1566484-1566506 CTCCAGTGGAGGCAGCCCCAAGG - Intronic
1077922811 11:6654700-6654722 CACAAGAGGACACAGTCCCAGGG - Intronic
1078866582 11:15303299-15303321 CCCAAGAGGATGCACTTTCATGG + Intergenic
1079982226 11:27163368-27163390 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1081490204 11:43562004-43562026 CCCAAGAGCATACATCCACATGG - Intronic
1083187998 11:61028711-61028733 CCCAGTGGGATGAAGCCCCAGGG + Intergenic
1083327438 11:61879916-61879938 CCCAAGGGGATGCAGAGCCAGGG - Intronic
1084306775 11:68290683-68290705 CTCCAGAGGATGCAGCAGCAAGG + Intergenic
1084850746 11:71937972-71937994 CCCAAGAGGATGCTGGATCATGG + Intronic
1085448492 11:76616789-76616811 CCCATGAGGAAGCAGACCCAGGG - Intergenic
1085459323 11:76683778-76683800 CCCAAGAGCATGAAGACCCATGG + Intergenic
1086307187 11:85493979-85494001 CTCCAGAGGATGCAGCAACAAGG - Intronic
1088991162 11:114954713-114954735 CTCAAAAGGATGCAGCAACAAGG - Intergenic
1089059923 11:115618184-115618206 ACGAAGAGGATGCATCCCAAGGG + Intergenic
1089404429 11:118185731-118185753 GCCAACAGAAAGCAGCCCCAAGG - Intergenic
1089490671 11:118881756-118881778 TCCAGGAGGAAGCTGCCCCAAGG - Intergenic
1091589993 12:1837207-1837229 GCCCAGAGGATGCTGCCGCACGG + Intronic
1091973108 12:4804701-4804723 CCCAGGAGGATGGGGCCCCTGGG + Intronic
1092679662 12:10964715-10964737 CTCAAGAAGATGCAGTTCCATGG - Intronic
1092681404 12:10986223-10986245 CTCAAGAAGATGCAGCTCCATGG - Exonic
1092682252 12:10997238-10997260 CTGAAGAAGATGCAGCTCCATGG - Exonic
1092684792 12:11030698-11030720 CTCAAGAAGATGCAGCTCCATGG - Exonic
1092686095 12:11048619-11048641 GTCAAGAAGATGCAGCTCCATGG - Intronic
1092687100 12:11061657-11061679 CTCAAAAAGATGCAGCTCCATGG - Exonic
1092688402 12:11077605-11077627 CTCAAGAAGATGCAGCTCCATGG - Intronic
1092689475 12:11091592-11091614 CTCAAGAAGATGCAGCTCCATGG - Exonic
1092692836 12:11133607-11133629 CTCAAGAAGATGCAGCTCCATGG - Exonic
1096196377 12:49651403-49651425 CCACAGAGGGTGCAGCACCAGGG + Exonic
1096492874 12:52022764-52022786 CCCAAGAAGACACAGCCTCAGGG - Intergenic
1096520237 12:52180862-52180884 CCCATGAGGAAGGAGCCCCTGGG + Intronic
1096664389 12:53153311-53153333 CCCAATGGGATGGAGCCCAAAGG + Intergenic
1102059648 12:109923037-109923059 GCCAATAGGATGCTGCCCCAAGG + Intronic
1104803302 12:131569390-131569412 CACTGGAGGAAGCAGCCCCAGGG + Intergenic
1105065457 12:133193511-133193533 CTCCAGAGGATGCAGCAACAAGG - Exonic
1105518428 13:21110932-21110954 CTCCAGAAGATGCAGCCACAAGG + Intergenic
1105557174 13:21458751-21458773 CCCAGAAGGATGCAGACCCCCGG + Intronic
1105823021 13:24096738-24096760 CCCAAGCAGAGGCTGCCCCAGGG + Intronic
1106194304 13:27480253-27480275 CCCAAGAGCATATAGACCCAAGG + Intergenic
1107126612 13:36853529-36853551 CCCCAGCGGCTGCAGCCTCAAGG - Exonic
1108452776 13:50584370-50584392 CTCCAGAGGATGCAGCGACAAGG - Intronic
1111312701 13:86510246-86510268 CTCAAGAAGATGCAGCAACAAGG - Intergenic
1114269351 14:21091620-21091642 CCCGAGGGGAAGCAGCCCTATGG - Intronic
1115106221 14:29764582-29764604 CCCATGAGGATGCAGCTACAAGG - Intronic
1116214298 14:41991414-41991436 CCCTAGAGTATGCAGCGACAAGG - Intergenic
1116648974 14:47565735-47565757 CCCCAGTGGATTCAGCCCCCAGG - Intronic
1116748517 14:48851698-48851720 CTCCAGAAGATGCAGCCACAAGG + Intergenic
1118592842 14:67413935-67413957 CCCAAGGTTATGCAGCTCCAGGG + Intergenic
1119506439 14:75176939-75176961 CCCAATAGGAAACAGCCACAAGG + Intergenic
1119652633 14:76394500-76394522 CCAAAGAGGATGCAGCCTTGTGG + Intronic
1121114133 14:91331684-91331706 CCCAACAGGGAGCTGCCCCAAGG - Intronic
1121626154 14:95386756-95386778 CACAGGAGGGAGCAGCCCCAGGG - Intergenic
1122694166 14:103544833-103544855 ACCTGGAGGCTGCAGCCCCAGGG - Intergenic
1123666766 15:22614436-22614458 CCCAAGAGGCAACAACCCCAGGG + Intergenic
1123707082 15:22958574-22958596 CCGAAGGGGCTGCAGCCCCAAGG - Intronic
1124320606 15:28709009-28709031 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124481887 15:30086340-30086362 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124488343 15:30138438-30138460 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124521705 15:30410861-30410883 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124536959 15:30555358-30555380 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124543433 15:30607412-30607434 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124755184 15:32399882-32399904 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124761692 15:32452233-32452255 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124776936 15:32596835-32596857 CCCAAGAGGCAACAACCCCAGGG - Intronic
1124889118 15:33715718-33715740 CTCCAGAGGATGCAGCAACATGG - Intronic
1124959892 15:34386367-34386389 CCCAAGAGGCAACAACCCCAGGG + Intronic
1124976519 15:34532588-34532610 CCCAAGAGGCAACAACCCCAGGG + Intronic
1125436186 15:39647432-39647454 CCCCAGATGATGCATCCACAGGG - Intronic
1125447909 15:39777295-39777317 TCCATGAAAATGCAGCCCCACGG - Intronic
1126104256 15:45136962-45136984 CCCAAAAGGTTGCAGGCCCTGGG - Intronic
1127774999 15:62257546-62257568 GGCAAGAGGCTGCAGCCCCAGGG - Intergenic
1129388577 15:75209074-75209096 TCCAAGAAGGTGCAGCACCAGGG - Intronic
1130926095 15:88386944-88386966 CCCAAGAGGAAGGAGATCCAAGG + Intergenic
1132711573 16:1271284-1271306 TCATAGAGGATGCAGGCCCACGG - Intergenic
1132855713 16:2043775-2043797 CCTGGGAGGATGCAGCCCCCAGG + Intronic
1133538124 16:6721774-6721796 CCCAAAAGGAAGCAGCTGCAGGG - Intronic
1134414197 16:14029818-14029840 CCCCAGAGGATGCTGCCCATGGG - Intergenic
1135387591 16:22057305-22057327 CTCAGGAGGATGCAGCATCAAGG - Intronic
1135995534 16:27244949-27244971 CCCAAGAGAATTCAGCCCTGTGG + Intronic
1136251468 16:29008394-29008416 CCCCAGAGCCAGCAGCCCCAGGG - Intergenic
1138038522 16:53634114-53634136 CTGAAGAGGATGCAGCAACAAGG - Intronic
1138190216 16:55008642-55008664 CCAAACAGGATGCATCACCACGG - Intergenic
1138297206 16:55897175-55897197 GCCAAGAGCATCCAACCCCAGGG + Intronic
1138400032 16:56738190-56738212 CCAGAGACGATCCAGCCCCAGGG + Intronic
1138965794 16:62082606-62082628 CACAAGATGATGCACCACCAAGG - Intergenic
1138990792 16:62388502-62388524 CCCAATAGGATGCAGAAACATGG - Intergenic
1139191260 16:64866117-64866139 CCCAACAGGACGGAGCCCTATGG + Intergenic
1139960790 16:70716230-70716252 CCCATGAGGCTGCAGCCCCGGGG + Intronic
1141092481 16:81139656-81139678 CCCACCAGGATGCACCACCAGGG + Intergenic
1141978129 16:87531839-87531861 TCCAAGAGGAAGCATCCCAAGGG + Intergenic
1143619187 17:8071525-8071547 CCCAAGAGGCTGCTGCCCTGGGG - Intergenic
1147182870 17:38697836-38697858 CCCAGGAGGATGAAGTCCCATGG - Intergenic
1147262075 17:39214548-39214570 CCCAAAGGCAGGCAGCCCCAGGG - Intronic
1148064231 17:44857032-44857054 TCCAGGAGGCTGCAGTCCCAGGG + Intronic
1148831721 17:50437100-50437122 CCCAAGAGGATGCAGCCCCATGG + Intronic
1148919628 17:51019136-51019158 CTCCAGAGGATGCAGCAACAAGG + Intronic
1150162485 17:62910431-62910453 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1151363621 17:73603487-73603509 CCCAAGGTGATGCACACCCAGGG + Intronic
1151834257 17:76572980-76573002 CCCAGGAGGAAGCAGCCGCCAGG - Intronic
1151850294 17:76685887-76685909 ACCAAGAGGTTGCTCCCCCATGG - Intronic
1152114533 17:78377450-78377472 CCCCAGAGGCTGCAGCTCCATGG - Intergenic
1153981001 18:10310518-10310540 CTCTAGAGGATGTAGCCCCAAGG + Intergenic
1155472702 18:26207570-26207592 AACAATAGGATGCAGTCCCAAGG - Intergenic
1157512809 18:48290682-48290704 AGGAAGAGGATGCAGGCCCAGGG - Intronic
1158045131 18:53146375-53146397 CCATAGAGGATGCAGCCACAAGG - Intronic
1159964416 18:74581433-74581455 CCCAGGAGGACACAGCCCCCAGG + Intronic
1160429247 18:78800288-78800310 GCCAAGGGGTAGCAGCCCCACGG + Intergenic
1160595320 18:79969445-79969467 CCCACGCGGATGCTTCCCCAGGG + Intronic
1160960641 19:1719150-1719172 CACGCGAGGCTGCAGCCCCAGGG + Intergenic
1161803208 19:6427102-6427124 CGCACCAGGATGCAGGCCCAAGG - Exonic
1162256901 19:9498152-9498174 CCCAAGATCCTGTAGCCCCACGG - Exonic
1162303068 19:9855152-9855174 CCCAAGAAACTGCAGCCCCTGGG - Intronic
1164471629 19:28541204-28541226 CTCAAGTGGAAGCAGCCCCAGGG - Intergenic
1164916292 19:32054872-32054894 CTCCAGAGGATGCAGCAGCAAGG - Intergenic
1164964892 19:32474381-32474403 CCCTAGCAGGTGCAGCCCCAAGG - Intronic
1165068264 19:33241264-33241286 CCCAGGAGGGACCAGCCCCAAGG - Intergenic
1167645658 19:50703672-50703694 CCCCAGAGGACGCGGCCCCCGGG + Exonic
1168124315 19:54275257-54275279 CCCATGAGGCTGCAGCCAAATGG - Intronic
926829172 2:16941557-16941579 GTCAAGAGGATGGAGACCCAGGG - Intergenic
927090511 2:19707224-19707246 CCAGAGAGGCAGCAGCCCCAGGG + Intergenic
928368432 2:30721480-30721502 CCCAAGGAGATGCAGCCTCGGGG + Intergenic
929418589 2:41768483-41768505 CAAAAAAGGATGCATCCCCAGGG - Intergenic
929647857 2:43647758-43647780 CCTAAATGGATGCAGGCCCAAGG + Intronic
930013672 2:46956508-46956530 CCCCAAAGACTGCAGCCCCAGGG - Intronic
931473264 2:62561723-62561745 CCCCAGAGGATTCAGTCACAAGG - Intergenic
935035927 2:99373376-99373398 CTCTGGAGGATGCAGCACCAAGG - Intronic
937836303 2:126473360-126473382 ACCAAGAAGATGGAGCCCCAGGG + Intergenic
938274536 2:130006198-130006220 CTCCAGAGTAGGCAGCCCCATGG - Intergenic
938440831 2:131331074-131331096 CTCCAGAGTAGGCAGCCCCATGG + Intronic
938554991 2:132416359-132416381 CCCAAGGAGGTGCAGCCCCGGGG - Intergenic
938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG + Intergenic
939838588 2:147158829-147158851 CCCAAGAGGGTGCAACCCCAGGG - Intergenic
939873138 2:147547420-147547442 CCCATGAGGATGGAGCCCTGTGG + Intergenic
940049888 2:149451185-149451207 CTCCAGAGGATGCAGCAGCAAGG - Intronic
941182801 2:162281628-162281650 CCCAAGAGAAGGCATCCCCAAGG - Intronic
941957383 2:171218661-171218683 CCCCAGAGGATGCAGCAACAAGG - Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946230307 2:218287138-218287160 ACTAAGAGGATGAAGCCACAGGG + Intronic
946844045 2:223843553-223843575 CCCTGGAGGATGCAGCAACAAGG + Intergenic
947337283 2:229100648-229100670 CCCATAAGGATGCAGATCCAAGG + Intronic
947995609 2:234524707-234524729 CTCCAGAGGATGCAGCAGCAAGG + Intergenic
948393562 2:237628540-237628562 GCCAATAGGTTGCGGCCCCAGGG + Intronic
948884545 2:240876182-240876204 GCCAGGGGGATACAGCCCCAGGG + Intronic
1170059538 20:12244831-12244853 CCCATGAGGAAGCTGCCTCATGG - Intergenic
1172651763 20:36508025-36508047 CAGAAAAGGATGCAGCCTCAGGG - Intronic
1174201505 20:48809459-48809481 CCCAGGAGGCAGCTGCCCCAGGG + Intronic
1174503879 20:51004480-51004502 CCCCAGCGTCTGCAGCCCCAGGG + Exonic
1175314423 20:58037722-58037744 GCCATGAGGATGCAGCCCAGGGG - Intergenic
1176211979 20:63929079-63929101 CCTCAGAGGAGGGAGCCCCAAGG - Intronic
1176298042 21:5084841-5084863 CCCAAGACCATGCAGCTGCAGGG + Intergenic
1177809867 21:25914523-25914545 CTCTGGAGGATGCAGCCACAAGG + Intronic
1179189070 21:39108003-39108025 CCCACGGGGACCCAGCCCCAGGG + Intergenic
1179790137 21:43751679-43751701 CACATGAGGATGCAGCAACAAGG - Intronic
1179858987 21:44177108-44177130 CCCAAGACCATGCAGCTGCAGGG - Intergenic
1180059319 21:45376469-45376491 GCCATGAGGATGCAGCAACAGGG - Intergenic
1180106885 21:45624510-45624532 CACATGAGGACGCAGCCACAGGG + Intergenic
1180203237 21:46239929-46239951 CCCATGGGGATGAAGGCCCAGGG - Intronic
1180888617 22:19268202-19268224 CTCCAGAGGATGCAGCAACAGGG + Intronic
1181464282 22:23102407-23102429 CCAGGGAGGATGCAGCCACAAGG + Intronic
1183189712 22:36313999-36314021 ACCCGGAGGATGAAGCCCCAAGG - Intronic
1184460468 22:44634946-44634968 CCCATGAGGTTGCACCCCCAGGG - Intergenic
1184712947 22:46263541-46263563 CCCAAGTGTGTGCAGGCCCAGGG + Intergenic
1184903244 22:47460962-47460984 CCCAAGGCCATGCAGCCACAAGG - Intergenic
1185153892 22:49181911-49181933 CCCACTAGCATGCAGGCCCAGGG + Intergenic
950313536 3:11979845-11979867 CCCAAGAGGATGCAGCAGCTTGG + Intergenic
951437807 3:22685298-22685320 CACAAGAGGATGCAGTCAGAAGG - Intergenic
952209821 3:31218942-31218964 CCAAAGAGCACACAGCCCCAAGG - Intergenic
954811030 3:53248035-53248057 TCAAAGAGGTTACAGCCCCAAGG - Intronic
954876874 3:53808063-53808085 CCCCACAGTATGCAGCGCCAGGG + Intronic
954972640 3:54664105-54664127 GCAAAGAGGTTGCATCCCCAAGG + Intronic
956837902 3:73110703-73110725 CCCACGAGGAGGCGGCCCCGGGG + Intergenic
958748057 3:98161758-98161780 CTCAAGAGGATGCAGCAAGAAGG - Intergenic
959310283 3:104727366-104727388 CCTAGGAAGATGCAGCGCCAAGG - Intergenic
959321910 3:104887229-104887251 CCCAGGAGGATGTAGCCTTATGG + Intergenic
960006117 3:112782833-112782855 CTCCAGAGGGTCCAGCCCCAGGG + Intronic
960148966 3:114232092-114232114 CCCAACAGACTGCAGTCCCATGG - Intergenic
960248141 3:115422325-115422347 CTCAGGAGGATGCAGCAACAAGG - Intergenic
960410891 3:117323068-117323090 CCCAAGATAATTCAGCACCATGG - Intergenic
961340834 3:126216410-126216432 CCCAGAAGGATGCAGCTTCAGGG - Intergenic
961671862 3:128538231-128538253 CCAAAGAGGATGCAACCAAAGGG + Intergenic
962953462 3:140242809-140242831 CTCAAGAGGTTGCATCCCCTAGG + Intronic
967728991 3:192889529-192889551 CCCTAGAGGCTGCAGCCTCAGGG - Intronic
968834277 4:2951585-2951607 GCCAAGAGCAAGCAGCTCCACGG + Intronic
969402761 4:6967883-6967905 CCCAAAAGTAGGCAGCCTCAGGG - Intronic
969711943 4:8849693-8849715 CCCATGTGGATGCAACCCCAGGG + Intronic
971230080 4:24794571-24794593 CCCCAGAGTATGAACCCCCAAGG + Intronic
973968272 4:56185734-56185756 CCCAAGGGGATTGAGCCCCATGG - Intronic
974514491 4:62891275-62891297 GCCAAGTGGATGCAGCCACTTGG - Intergenic
975241576 4:72066157-72066179 CTCCAGAGGATGCAGCAACAAGG - Intronic
976425723 4:84901038-84901060 CTCCAGAGGATGCAGCAACAAGG - Intronic
979288284 4:118951281-118951303 CTCCAGAGGATGCAGCAACAAGG - Intronic
979743340 4:124179024-124179046 TCCCAGAGGATGAAGCCCCATGG + Intergenic
984358080 4:178690943-178690965 CCCTGGAGGATGCAGCAACAAGG + Intergenic
986222023 5:5776501-5776523 CCCAGGAGGATGAGGACCCAGGG + Intergenic
986276006 5:6275678-6275700 CAAAGGAGGATGCAGCTCCAGGG + Intergenic
986958243 5:13182062-13182084 CTCCAGAGGATGCAGCGACAAGG + Intergenic
987175149 5:15300294-15300316 CCGGCGAGGATGCAGCACCAAGG + Intergenic
987817512 5:22922127-22922149 CTCCAGAGGATGCAGCCATAAGG - Intergenic
989321687 5:40142337-40142359 CTTAAGAAGATGGAGCCCCAGGG - Intergenic
989954257 5:50338264-50338286 CTCCAGAGGATGCAGCAACAAGG - Intergenic
992521188 5:77553304-77553326 CTCAAGAGGATGCAGCAACAGGG - Intronic
994652648 5:102548503-102548525 CCCAAGAAAATGCAGCCAGAAGG + Intergenic
996605014 5:125311646-125311668 CCCCAGTGACTGCAGCCCCAGGG + Intergenic
997527811 5:134564701-134564723 CCCATCAGTCTGCAGCCCCATGG - Intronic
1000043565 5:157503066-157503088 CCCAGGTGGAGTCAGCCCCACGG - Intronic
1001017093 5:168151608-168151630 CCCAAGATCATGCAGCCAAAGGG + Intronic
1001136564 5:169107544-169107566 CCCAAGGGGTGACAGCCCCAGGG + Intronic
1001559864 5:172661940-172661962 ACCAAGGGGAAGCAACCCCAGGG + Intronic
1002020544 5:176361552-176361574 CGCCAGAGAACGCAGCCCCAAGG + Intronic
1002676180 5:180915047-180915069 CCCCAGATGATTCAGCCACATGG - Intronic
1005169314 6:22964197-22964219 CACAAGAGAATGCAACCCAAAGG + Intergenic
1006578964 6:35065643-35065665 CCCAGGAAGATGCAGCCCCTGGG + Intronic
1006928273 6:37671490-37671512 CTCATTAGGATGCTGCCCCAAGG - Intronic
1007493144 6:42239982-42240004 CCCAAGAGGGTGTGGCCCCTTGG + Intronic
1010011428 6:71051864-71051886 CTCAAGAGTGTACAGCCCCAGGG - Intergenic
1011813066 6:91155296-91155318 CCAGAGAGGATGCAGCACCACGG - Intergenic
1013178217 6:107695101-107695123 CCCAGGAGGTTGAAGCCACAGGG + Intergenic
1013191684 6:107809167-107809189 CTCTAGAGGATGCAGCAACAAGG + Intronic
1013888934 6:115002265-115002287 CCAAAGAGTGTGCAGCGCCAAGG - Intergenic
1017791568 6:157804526-157804548 GCCAACAGGATGGAGACCCAGGG + Intronic
1018847753 6:167567056-167567078 GCCCAGAGGATGGAGCCCCACGG + Intergenic
1019235700 6:170610437-170610459 CCCAAGGCGAGGCAGCCACAGGG - Intergenic
1022421711 7:30229748-30229770 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1023141458 7:37106424-37106446 CTCCAGAGGATGCAGCGCCAAGG + Intronic
1023385406 7:39652100-39652122 CCCTAGAGGATGCAGCAATAAGG - Intronic
1024056196 7:45661126-45661148 CCCCAGTGGATGCAGGCCCCTGG + Intronic
1024105335 7:46078881-46078903 CTCAGGAGGATGCAGCAACAAGG - Intergenic
1026396280 7:69957773-69957795 CCCAAGTGGATTCAGTTCCAGGG + Intronic
1029573723 7:101388989-101389011 CCCAAGAAGGGGAAGCCCCATGG - Intronic
1033282391 7:140015500-140015522 CCCAGGAGCCTGCAGCCCCGAGG - Intronic
1034428333 7:151026756-151026778 CCCAAGAAGCTGCAGCCCAGTGG + Intergenic
1035851394 8:2922437-2922459 CTCCAGAGGATACAGCCACAAGG + Intergenic
1037496162 8:19443064-19443086 CCCAGGAGGGTGCAGCCGAATGG - Intronic
1037589758 8:20303127-20303149 CCCAGGAAGCTGCAGCCCCAGGG + Intronic
1037887686 8:22603497-22603519 CCCAAGATGCCGCAGCTCCAGGG + Exonic
1038325793 8:26571803-26571825 GCTAAAAGGATGCAGCCACAGGG + Intronic
1038589677 8:28825149-28825171 CCCAGGAGGTTCAAGCCCCAGGG - Intronic
1041117138 8:54550826-54550848 CCTGAGAGGAAGCAACCCCAGGG + Intergenic
1042103382 8:65297972-65297994 TTCAAGAGGAAGCTGCCCCATGG + Intergenic
1042473667 8:69220361-69220383 CCAAAGTGGCTGTAGCCCCAGGG - Intergenic
1044842246 8:96346364-96346386 CCTAAGTGTATGAAGCCCCAAGG - Intergenic
1044885589 8:96773786-96773808 CTCCAAAGGATGCAGCCACAGGG - Intronic
1045958238 8:107935178-107935200 CCTAAGAGAATGCATTCCCATGG + Intronic
1046262557 8:111788047-111788069 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1048677441 8:136799642-136799664 CCCATGACAATGCAGCCACAAGG - Intergenic
1050352198 9:4750914-4750936 CTCAGGAGGGTGGAGCCCCATGG + Intergenic
1051337913 9:16083686-16083708 CCTAAGAGGTTCCATCCCCAGGG - Intergenic
1051922876 9:22288274-22288296 CTCCAGAGGATGCAGCATCAAGG - Intergenic
1056803335 9:89709143-89709165 CCCAAGAGGGAGCATCCCAAGGG + Intergenic
1057222527 9:93264936-93264958 GCCAGGGGGATGCAGCCCAAGGG - Intronic
1057373564 9:94497032-94497054 CCCAAAAGGTTGCAGCAGCAGGG - Intergenic
1058452079 9:105106487-105106509 CCCTGGAGGATGCAGCAACAAGG - Intergenic
1059416927 9:114168132-114168154 CCAAAGAGGAAGGAGCCCCCAGG - Exonic
1060520157 9:124289864-124289886 CCCAAGACCATGCAGCCCTATGG + Intronic
1060526583 9:124324365-124324387 CCCGAGAGCCTGCAGCCTCAAGG + Intronic
1060794333 9:126504109-126504131 CCCAGGAGGATACAGGCACACGG + Exonic
1061063430 9:128262541-128262563 GGCAAGAGGCTGCAGCCCCATGG - Exonic
1061064113 9:128266929-128266951 CCCAAGAGGCAACAACCCCAGGG + Intronic
1061341694 9:129987121-129987143 CAAAAGACGATGCAGCCACATGG + Intronic
1061796222 9:133087287-133087309 GCCGAGAGGGTGCAACCCCAGGG + Intronic
1185569571 X:1123276-1123298 CCCAAGAGGCTGCAACCTCGAGG + Intergenic
1186815882 X:13237667-13237689 CCAAAGAACATGCAGCTCCACGG - Intergenic
1187682224 X:21778973-21778995 TACAAGAAGATGCAGCCCCATGG + Intergenic
1188249901 X:27879978-27880000 CTCCAGAGGATGCAGCAACAAGG - Intergenic
1189380097 X:40496500-40496522 CTCCAGAGGATGCAGCAACAAGG + Intergenic
1190952868 X:55163040-55163062 CCTCAGAGAATGCAGCCCCTTGG - Intronic
1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG + Intronic
1193298616 X:79862421-79862443 CCGTAGAGGAGGAAGCCCCATGG - Intergenic
1194752324 X:97698765-97698787 CTCCAGAGGATGCAGCAACATGG + Intergenic
1196752432 X:119130003-119130025 GCTCAGAGGAGGCAGCCCCAAGG - Intronic
1200162406 X:154016311-154016333 CCCAGGAGGCTGCAGCTCCAGGG - Intronic
1201364279 Y:13186435-13186457 CCCACAAGGCTGCAGCCTCATGG - Intergenic