ID: 1148832189

View in Genome Browser
Species Human (GRCh38)
Location 17:50440835-50440857
Sequence GTGAGCCAGCTCACCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1160
Summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 1089}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148832189_1148832190 2 Left 1148832189 17:50440835-50440857 CCAGGAGAGGTGAGCTGGCTCAC 0: 1
1: 0
2: 3
3: 67
4: 1089
Right 1148832190 17:50440860-50440882 GAGCAGAACAATGAGAGAAGAGG 0: 1
1: 0
2: 5
3: 70
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148832189 Original CRISPR GTGAGCCAGCTCACCTCTCC TGG (reversed) Intronic
900031482 1:375920-375942 GTGAGCCACCGCACCTGGCCAGG - Intergenic
900281751 1:1874186-1874208 GTGAGCCACCGCACCTGGCCAGG - Intronic
900627037 1:3613080-3613102 GTGAACTAGCTCACCTCTTGGGG - Intergenic
900656000 1:3757638-3757660 GTGAGCCACCTCGCCTGGCCGGG - Intronic
901108151 1:6773716-6773738 GTGAGCCACCTCACCCAGCCTGG - Intergenic
901384819 1:8900924-8900946 ATGAGCCACCGCACCTGTCCTGG + Intergenic
901461993 1:9397578-9397600 GTGAGCCACCGCACCTGGCCTGG + Intergenic
901605309 1:10454568-10454590 GTGAGCCACCGCACCTGGCCAGG - Intergenic
901895864 1:12311196-12311218 GTGAGCCACCACACCTGGCCTGG + Intronic
902574501 1:17368882-17368904 GTGAGCCATCACACCTGGCCTGG + Intergenic
902670290 1:17968387-17968409 GTGGTCCTGCTCACCTTTCCTGG - Intergenic
902807073 1:18867829-18867851 GTGAGCCAGCACGCCTGGCCGGG + Intronic
903131688 1:21283667-21283689 GTGAGGCAACCCACGTCTCCAGG + Intronic
903211099 1:21819089-21819111 GTGAGCCACCGCACCTGGCCAGG - Intronic
903638227 1:24835278-24835300 GTGAGCCACCGCACCTGACCCGG - Intronic
903649477 1:24914125-24914147 GTGACCCAGCTCTTCTCTCATGG - Intronic
903972512 1:27128372-27128394 GTGAGCCACCTCCCCTGGCCTGG - Intronic
904540910 1:31232569-31232591 GTGAGCCACCGCACCTGGCCTGG + Intronic
904864601 1:33568467-33568489 GTGAGCCACCACACCTAGCCTGG + Intronic
905030923 1:34884199-34884221 GTGAGCCACCGCACCTGGCCTGG + Intronic
905211187 1:36375222-36375244 GTGAGCCATCACACCTGGCCAGG - Intronic
905262030 1:36726505-36726527 GTGAGCCACCACACCTGGCCAGG - Intergenic
905384771 1:37594821-37594843 GTGAGCCACCACACCTGGCCAGG + Intronic
905567328 1:38976072-38976094 GTGAGCCACCGCACCTGGCCAGG - Intergenic
905698380 1:39992988-39993010 GTGAGCCACCGCACCTGGCCCGG + Intergenic
905707770 1:40074970-40074992 GTGAGCCACCGCGCCTGTCCTGG - Intronic
905802582 1:40854680-40854702 GTGAGCCACCGCACCTGTCTGGG + Intergenic
905850872 1:41273761-41273783 GTGGGTCACCTCACCTCTCCGGG - Intergenic
905859434 1:41339920-41339942 GTGAGCCACCACACCTGGCCAGG + Intergenic
906032246 1:42730924-42730946 GTGAGCCACCACACCTGGCCTGG + Intergenic
906369268 1:45238570-45238592 GTGAGCCACCGCACCTGGCCAGG - Intronic
906411393 1:45582297-45582319 GTGAGCCAGGTCACGTAACCCGG - Intergenic
906475425 1:46166498-46166520 GTGAGCCACCACACCTGGCCAGG + Intronic
906508639 1:46398215-46398237 GTGAGCCACCTCACCCGGCCAGG + Intronic
906747420 1:48231732-48231754 GTGAGCCATGTCCCCTCTCCAGG + Intronic
907208108 1:52793120-52793142 GTGAGCCAGCACACCCAGCCTGG + Intronic
907515985 1:54993711-54993733 GTGAGCCATCACACCTGGCCTGG - Intergenic
907654264 1:56326388-56326410 GTGAGCCACCACACCTGGCCTGG - Intergenic
909024267 1:70464361-70464383 GTGAGCCACCACACCTGGCCTGG - Intergenic
909568110 1:77078500-77078522 GTAAGCCAGCCCATCTCTCAAGG + Intergenic
910807799 1:91205861-91205883 GTGAGCCACCACACCTGGCCAGG + Intergenic
910920555 1:92341923-92341945 GTGAGCCAACACACCTGGCCAGG + Intronic
911616421 1:100016653-100016675 GTGAGCCACCTCGCCTGGCCCGG + Intronic
911639206 1:100268904-100268926 GTGAGCCACCGCACCTGGCCTGG - Intronic
912074999 1:105863028-105863050 GTGAGCCACCACACCTGGCCTGG - Intergenic
912277951 1:108280476-108280498 GTGAGCCACCACACCTGGCCAGG + Intergenic
912290275 1:108413881-108413903 GTGAGCCACCACACCTGGCCAGG - Intronic
913138733 1:115918225-115918247 ATGAGCCACCGCACCTCGCCGGG + Intergenic
913694201 1:121308491-121308513 ATGAGCCACCTCACCTGGCCAGG - Intronic
914143362 1:144971575-144971597 ATGAGCCACCTCACCTGGCCAGG + Intronic
914811728 1:151033670-151033692 GTGAGCCACCGCACCCCGCCCGG + Intronic
914873731 1:151497110-151497132 GTGAGCCACCGCACCTGGCCTGG - Intergenic
914905322 1:151739050-151739072 GTGAGCCACCACACCTAGCCAGG + Intergenic
915095188 1:153457574-153457596 GAGAGGCAGCTCAGCTCTGCTGG + Intergenic
915178701 1:154039516-154039538 GTGAGCCACCGCACCTGGCCTGG + Intronic
915285080 1:154847221-154847243 GGGAGCCTGCACATCTCTCCAGG + Intronic
915407389 1:155671146-155671168 GTGAGCCAGCACGCCTGGCCTGG - Intronic
916019952 1:160782910-160782932 GTGAGCCAGTGCACCTGGCCAGG + Intergenic
916228865 1:162519032-162519054 ATGAGCCACCTCACCTGGCCTGG - Intronic
916722099 1:167492282-167492304 CTGAGCCTGCTGACCTCTTCCGG - Intronic
917048675 1:170892913-170892935 GTGAGCCACCGCACCTGGCCTGG - Intergenic
917815646 1:178707254-178707276 GTGAGCCACCGCACCTGGCCAGG - Intergenic
918210212 1:182343711-182343733 CTCACCCAGCTCACCTCTCCTGG - Intergenic
919184360 1:194125799-194125821 GTGAGCCACCGCACCTAGCCAGG - Intergenic
919544313 1:198894881-198894903 ATGAGCCACCTCACCTCACCAGG - Intergenic
920287453 1:204890850-204890872 GTGAGCCACCGCACCTGGCCAGG + Intronic
920325628 1:205161054-205161076 GTGAGCCACCACACCTGGCCTGG + Intronic
920345072 1:205301284-205301306 CTTTGCCAGCTCAGCTCTCCAGG + Intergenic
920481528 1:206326878-206326900 ATGAGCCACCTCACCTGGCCAGG - Intronic
920527628 1:206679444-206679466 GTGAGCCACCACACCTGGCCAGG - Intronic
920602966 1:207347540-207347562 GTGAGCCACCGCACCTGGCCAGG + Intronic
920863536 1:209731987-209732009 GTGAGCCACCACACCTGGCCAGG + Intronic
921069968 1:211650608-211650630 ATGAGCCACTTCACTTCTCCTGG + Intergenic
921205179 1:212842688-212842710 GTGAGCCACCGCACCTGGCCTGG - Intronic
921257568 1:213356371-213356393 GTGAGCCACCACACCTGGCCTGG - Intergenic
921286468 1:213614153-213614175 GTGAGCCACTTCACCTCTCTGGG - Intergenic
921364208 1:214358412-214358434 GTGGGCCACCACACCTGTCCTGG + Intronic
921539180 1:216392214-216392236 GTGAGCCACCACACCTGGCCAGG - Intronic
921640160 1:217543549-217543571 GTGAGCCACCACACCTGGCCAGG + Intronic
921689383 1:218130466-218130488 GTGAGCCACCGCACCTGGCCTGG + Intergenic
921830730 1:219724824-219724846 GTGAGCCACCGCACCTCTCCAGG - Intronic
922418432 1:225442959-225442981 AGCAGCCAGGTCACCTCTCCAGG - Intergenic
922497992 1:226075516-226075538 GTGAGCCACCTCACCCAGCCAGG - Intergenic
922554343 1:226521489-226521511 GTGAGCCACCACACCTGGCCAGG - Intergenic
922805092 1:228381997-228382019 GTGAGCCACCTCACCTTAACAGG + Intergenic
923220488 1:231888460-231888482 GTGAGCCACCGCACCTGGCCTGG - Intronic
923489525 1:234472052-234472074 GTGAGCCACCGCACCCGTCCAGG - Intronic
923562996 1:235055615-235055637 GTGAGCCACCGCACCTGGCCTGG - Intergenic
923564164 1:235064206-235064228 GTGAGCCACCGCACCTGGCCTGG - Intergenic
924084945 1:240441273-240441295 GTGAGCCACCACACCTGGCCTGG + Intronic
924327164 1:242907456-242907478 GTGAGCCACCGCACCTGGCCAGG - Intergenic
924339781 1:243018120-243018142 GTGAGCCACCGCCCCTGTCCAGG + Intergenic
924525720 1:244846227-244846249 GTGAGCCACCGCACCTGGCCAGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
924744906 1:246822728-246822750 ATGAGCCAGCACACCTGGCCTGG - Intergenic
1062816137 10:501860-501882 GTGAGCCAGCACACCTGGCCAGG - Intronic
1062832030 10:612011-612033 GTGAGCCACCGCACCCGTCCTGG - Intronic
1062988477 10:1791955-1791977 GTGAGCCACCGCACCCCACCAGG + Intergenic
1063136991 10:3226450-3226472 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1063414319 10:5861153-5861175 GTGAGCCACCGCACCCCGCCTGG - Intergenic
1063502998 10:6571521-6571543 GTGAGCCACCCCACCTATCAAGG - Intronic
1063612307 10:7573058-7573080 GTGAGCCAGTACACCTGGCCTGG + Intronic
1064102688 10:12477131-12477153 GTGAGCCACCGCACCTAGCCAGG - Intronic
1064286994 10:14000362-14000384 GTGAGCCACCACACCTGCCCCGG - Intronic
1064387945 10:14914660-14914682 GTGAGCCACCACACCTGGCCTGG - Intronic
1064783721 10:18870939-18870961 GTGAGCCACTTCACCTGGCCAGG + Intergenic
1065054797 10:21833980-21834002 GTGAGCCACCGCACCTGGCCTGG - Intronic
1065847488 10:29758051-29758073 GTGAGTCAGCTCTGCTCCCCTGG + Intergenic
1065926766 10:30441437-30441459 GTGAGCCACCGCACCTGGCCAGG + Intronic
1066359112 10:34713473-34713495 GTGAGCCACCGCACCTGGCCTGG - Intronic
1066409876 10:35157346-35157368 GTGAGCCACCACACCTGGCCTGG - Intronic
1066586210 10:36939395-36939417 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1068730297 10:60350767-60350789 GGAACCCAGCTCACCTTTCCTGG - Intronic
1068755518 10:60648439-60648461 GTGAGCCACCGCACCTGGCCTGG + Intronic
1069676239 10:70250191-70250213 GTGAGCCACCACACCTGGCCTGG + Exonic
1069729471 10:70601544-70601566 GTGAGCCACCACACCTGGCCAGG - Intronic
1070104387 10:73417431-73417453 GTGAGCCAACTCACCCAGCCAGG - Intergenic
1070127268 10:73632480-73632502 GTGAGCCACCGCACCGCACCTGG - Intronic
1070238169 10:74652324-74652346 ATGAGCCAGCACACCTGGCCAGG + Intronic
1070620732 10:78008725-78008747 GTGAGCCACCTCACCCAGCCAGG - Intronic
1070854807 10:79599157-79599179 GTGAGCCACCACACCTGTCCAGG - Intergenic
1071549839 10:86558180-86558202 GTGAGCCACCACACCTGGCCTGG + Intergenic
1071753053 10:88503096-88503118 GTGAGCCACCACACCTGACCAGG - Intronic
1072046744 10:91664413-91664435 GTGAGCCACCACACCTGGCCTGG + Intergenic
1072056314 10:91760614-91760636 GTGAGCCACCTCACCCAGCCAGG - Intergenic
1072250994 10:93582260-93582282 GTGAGCCACCGCACCTGGCCTGG - Intronic
1072326612 10:94305144-94305166 GTGAGCCACCGCACCTGGCCAGG - Intronic
1072340326 10:94441128-94441150 GTGAGCCATCGCACCTGTCCTGG + Intronic
1072342097 10:94461971-94461993 GTGAGCCACCACACCTGTCCTGG + Intronic
1072468069 10:95685942-95685964 GTGAGCCATCTCACCCCTCCTGG - Intronic
1072526237 10:96274051-96274073 GTGAGCCACCACACCTGGCCGGG + Intergenic
1073078845 10:100843654-100843676 GTGAGCAACCTCACCTGGCCAGG + Intergenic
1073225276 10:101913261-101913283 GTGAGCCACCACACCTGGCCAGG + Intronic
1073261155 10:102191417-102191439 GTGAGCCACCACACCTGGCCAGG + Intergenic
1073463968 10:103683075-103683097 GTGAGCCACCACACCTGGCCTGG - Intronic
1074281927 10:112060247-112060269 GTGAGCCACCACACCTGGCCTGG - Intergenic
1074337965 10:112597498-112597520 GTGAGCCACCACACCTGGCCTGG + Intronic
1074558336 10:114512540-114512562 GTGAGCCACCACACCTGGCCTGG - Intronic
1074806796 10:117061751-117061773 ATGAGCCACCACACCTCGCCAGG + Intronic
1075038196 10:119086831-119086853 GTGAGCCACCTCGCCCCGCCAGG - Intergenic
1075040379 10:119103448-119103470 GTGAGCCACCTCACCTGGCCTGG + Intergenic
1075076586 10:119355496-119355518 GTGAGCCACCACACCTAGCCAGG - Intronic
1075213505 10:120511809-120511831 GTGAGCCACCGCACCTGGCCCGG - Intronic
1075296668 10:121282810-121282832 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1075641754 10:124069763-124069785 GTCAGCCAGCTCATCCCTCGAGG + Intronic
1075766896 10:124900302-124900324 GTGAGCCACCACACCTGGCCAGG - Intergenic
1075885989 10:125899491-125899513 GTGAGCCAGCACACCCAGCCTGG + Intronic
1075921893 10:126220423-126220445 TTTATCCAGCTCTCCTCTCCAGG - Intronic
1076053462 10:127352873-127352895 GTGAGCCACCGCACCTGGCCTGG + Intronic
1076488353 10:130839018-130839040 GTGAGCCACCTCACCCGGCCAGG - Intergenic
1076520764 10:131079528-131079550 GGCAGCCAGGTGACCTCTCCTGG + Intergenic
1076795533 10:132796260-132796282 GTGAGCCTGCTCCTCCCTCCGGG - Intergenic
1077072959 11:685731-685753 GTGAGCCACCACACCTGGCCTGG - Intronic
1077578216 11:3400338-3400360 GTGAGCCACCACACCTGGCCGGG - Intergenic
1077899174 11:6475969-6475991 GTGAGCCACCGCACCTGGCCAGG + Exonic
1078134892 11:8643622-8643644 GTGAGCCACCGCACCTGGCCTGG + Intronic
1078316662 11:10299054-10299076 GTGAGCCACCACACCTGGCCAGG - Intergenic
1078755037 11:14201056-14201078 GTGAGCCACCGCACCTGGCCAGG - Intronic
1078908863 11:15712448-15712470 GTGAGCCAGCACACCCAGCCAGG - Intergenic
1078992031 11:16658424-16658446 GTGAGCCACCGCACCTGGCCAGG - Intronic
1079377563 11:19907240-19907262 GAGAGCCAGTTCTCCACTCCTGG + Intronic
1079495570 11:21039466-21039488 GTGAGCCACCACACCTGGCCAGG + Intronic
1080448583 11:32359802-32359824 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1080931574 11:36816963-36816985 GTGAGCCACCTCACCTGGCTAGG + Intergenic
1081394824 11:42574377-42574399 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1081701607 11:45155970-45155992 GTGAGTCACCTCACTTCTCTGGG - Intronic
1081747674 11:45484394-45484416 GTAAACCAGCTCCCCTGTCCAGG + Intergenic
1081778023 11:45689843-45689865 GTGGGCCAGCGCCCTTCTCCAGG + Intergenic
1082011788 11:47454731-47454753 GTGAGCCAACACACCTGGCCAGG + Intergenic
1082075907 11:47975983-47976005 GTGAGCCACCACACCTGGCCAGG - Intergenic
1082099064 11:48156867-48156889 GTGAGCCATCACACCTGGCCTGG + Intronic
1082186904 11:49193875-49193897 GTGAGCCACCTCACCTGGCCAGG - Intronic
1083029915 11:59583026-59583048 GTGAGCCACCCCACCTGGCCTGG - Intronic
1083189615 11:61040519-61040541 GTGAGCCACCGCACCTGTCTTGG - Intergenic
1083296416 11:61717878-61717900 TTCAGCCACCTCACCTCTGCAGG + Intronic
1083350876 11:62028001-62028023 GTGAGCCACCACGCCTCGCCTGG - Intergenic
1083580201 11:63819777-63819799 GTGAGCCACCGCACCTGACCAGG + Intronic
1083656354 11:64231620-64231642 GTGAGCCACCGCGCCTGTCCAGG + Intronic
1083690557 11:64405921-64405943 GTGAGCCACCACACCTGGCCTGG + Intergenic
1083839112 11:65293325-65293347 GTGAGCCACCACACCTGGCCTGG - Intronic
1083931142 11:65846286-65846308 GTGAGCCACCGCACCCGTCCTGG - Intronic
1083943110 11:65908833-65908855 GTGAGCCACCACACCTGGCCTGG + Intergenic
1084307345 11:68295687-68295709 GTGAGCCACCACACCTGGCCTGG - Intergenic
1084384192 11:68832164-68832186 GTGAGCCACCGCACCTGGCCTGG - Intronic
1084793765 11:71490968-71490990 GTGAGCACACTCACCTCTGCAGG - Exonic
1085182105 11:74544509-74544531 GTGAGCCACCACACCTGGCCAGG - Intronic
1085387760 11:76166858-76166880 GTGAGCCACCTTACCTGACCTGG + Intergenic
1085418015 11:76332307-76332329 GTGAGCCACCACACCCCGCCTGG + Intergenic
1085430220 11:76441626-76441648 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1085758752 11:79223792-79223814 GTGAAGCATCTCCCCTCTCCTGG + Intronic
1085913639 11:80858526-80858548 GTGAGCCACCACGCCTGTCCCGG + Intergenic
1086454373 11:86946921-86946943 GTGAGCCACCACACCTGGCCTGG - Exonic
1086837326 11:91640930-91640952 ATGAGCCAGCACACCACTACGGG - Intergenic
1087053561 11:93909634-93909656 GTGAGCCACCACACCTGGCCAGG + Intergenic
1087102708 11:94380713-94380735 CTGAGCCAGCTGACCTCTTCTGG - Exonic
1087440036 11:98171823-98171845 GTGAGCCACCGCACCTGGCCCGG + Intergenic
1087813694 11:102635464-102635486 GTGAGCCACCACACCTGGCCTGG - Intergenic
1087842427 11:102934379-102934401 GTGAGCCACCACACCTAGCCAGG - Intergenic
1088094676 11:106084895-106084917 GTGAGCCATCACACCTGGCCGGG + Intronic
1088241191 11:107775326-107775348 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1088345869 11:108824311-108824333 ATGAGCCACCGCACCTGTCCTGG + Intronic
1088540404 11:110907896-110907918 GTGAGCCAACTCATCTGTCCAGG + Intergenic
1088582265 11:111327801-111327823 GTGGGCCACCTCATCTCTCCAGG - Intergenic
1088886699 11:114013287-114013309 GTGAGCCACCACACCTGGCCAGG - Intergenic
1089243936 11:117104528-117104550 GTGAGCCACCACACCTGGCCAGG + Intergenic
1089677866 11:120102318-120102340 GAGACCCAGATCCCCTCTCCAGG + Intergenic
1089680872 11:120118209-120118231 GTGGGCAAGCTCACCTTTCAGGG + Exonic
1089846714 11:121464588-121464610 GTGAATCATTTCACCTCTCCGGG + Intronic
1090791578 11:130094469-130094491 GTGAGCCACCGCACCTGGCCGGG + Intronic
1090801516 11:130175664-130175686 GTGAGCCACCACACCTGGCCTGG + Intronic
1090877197 11:130801286-130801308 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1091452808 12:584255-584277 GTGAGCCACCGCACCTGGCCAGG - Intronic
1091803090 12:3337250-3337272 GAGAGCCACCTCACCCCTCCAGG + Intergenic
1091901193 12:4145468-4145490 GTGAGCCACCTCACCTGGCCAGG + Intergenic
1092207580 12:6624900-6624922 GTGAGCCACCGCACCTGGCCTGG + Intronic
1092530651 12:9341919-9341941 GTGAGCCACCACACCTGGCCAGG + Intergenic
1092681920 12:10992693-10992715 GTGAGCCACCTCACCAGTCCTGG + Intronic
1092980660 12:13791179-13791201 GTGAGCCACCGCGCCTCGCCAGG - Intronic
1093105897 12:15086709-15086731 GTGAGCCATCTCAACAATCCAGG + Intergenic
1093499544 12:19796471-19796493 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1093539660 12:20266150-20266172 GTGAGCCACCACACCTGGCCAGG - Intergenic
1093696568 12:22167290-22167312 GTGAGCCACCACACCTGGCCTGG - Intronic
1093731611 12:22571689-22571711 GTGAGCCACCACACCTGGCCAGG + Intergenic
1094245717 12:28289972-28289994 GTGAGCCACCACACCTGGCCTGG + Intronic
1094456916 12:30645089-30645111 GTGAGCCACCGCACCTGGCCTGG - Intronic
1095671166 12:44861563-44861585 GAGGGCCAGCTCAGCTCTCGGGG - Intronic
1096055541 12:48648314-48648336 GTGAGCCACCGCACCTGGCCCGG - Intergenic
1096229931 12:49891136-49891158 GTGAGTCAGCCAGCCTCTCCTGG + Intronic
1096283059 12:50273235-50273257 GTGAGCCACCACACCTGGCCTGG + Intronic
1096663563 12:53146053-53146075 GTGAGCCACCTCGCCTGGCCTGG - Intergenic
1097213423 12:57390727-57390749 GTGAGCCACCTCACCCAGCCTGG - Intronic
1097519938 12:60655104-60655126 GTGAGCCATCGCACCTGGCCTGG - Intergenic
1097752062 12:63366338-63366360 GTGAGCCACCACACCCCGCCAGG + Intergenic
1098160594 12:67645408-67645430 GTGAGTCACCACACCTGTCCAGG - Intergenic
1098538940 12:71629447-71629469 GTGAGCCAGCGCACCCAGCCTGG + Intronic
1099120867 12:78687599-78687621 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1099122114 12:78703586-78703608 GTGAGCCACCGCGCCTCGCCAGG + Intergenic
1100117468 12:91324875-91324897 GTGAGCCACCACACCTGACCTGG + Intergenic
1100235121 12:92653010-92653032 GTGAGCCACCGCACCTCGCCAGG - Intergenic
1100259826 12:92922668-92922690 GTGAGCCACCGCACCCCGCCAGG - Intronic
1100462571 12:94815665-94815687 GTGAGTCACCTCACCTGGCCAGG - Intergenic
1100513580 12:95302941-95302963 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1100530875 12:95460440-95460462 GTGAGCCACTTCACCTGGCCTGG - Intergenic
1100609065 12:96176016-96176038 GTGAGCCACCACGCCTGTCCAGG - Intergenic
1101145172 12:101833838-101833860 GGGAGCCACCTCACCTGGCCTGG + Intergenic
1101444149 12:104725402-104725424 GTGAGTCAGTTCACCTCTCTGGG + Intronic
1101883444 12:108641560-108641582 GTTAGCCTGAGCACCTCTCCTGG + Intergenic
1102020868 12:109681772-109681794 GTGAGCCACCACACCTGGCCAGG - Intergenic
1102192311 12:110998038-110998060 ATGAGCCAGCTTACCTGTCTGGG - Intergenic
1102549282 12:113679477-113679499 GTGAGCCACCACACCTGACCAGG - Intergenic
1102760958 12:115384593-115384615 GTGAGACACCTCACCTGGCCTGG - Intergenic
1102956087 12:117059872-117059894 GTGAGCCATTGCACCTGTCCAGG + Intronic
1103126102 12:118423966-118423988 GTGAGCCACCACACCTGGCCAGG - Intergenic
1103340493 12:120218656-120218678 GTGAGCCACCACACCTGGCCCGG + Intronic
1103368464 12:120400436-120400458 GTGAGCCACCACACCACACCTGG + Intergenic
1103383176 12:120510986-120511008 GTGAGCCACCGCACCTGGCCAGG - Intronic
1103467046 12:121150049-121150071 GTGAGCCATGTCACCCCTCCAGG - Intronic
1103471552 12:121185771-121185793 GTGAGCCACCACACCTGGCCAGG - Exonic
1103698171 12:122833936-122833958 GTGAGCCACCACACCCCGCCAGG - Intergenic
1103776223 12:123368322-123368344 GTGAGCCACCACACCTGGCCTGG - Intergenic
1104051304 12:125195679-125195701 GTGAGCCACCGCACCTGGCCAGG + Intronic
1104396100 12:128434568-128434590 GTGAGCCACCGCACCTGGCCTGG + Intronic
1104410345 12:128552624-128552646 GTGAGCCATCGCACCTGGCCAGG - Intronic
1104450307 12:128863658-128863680 GTGAGCCACCGCACCTGGCCTGG + Intronic
1104687361 12:130796209-130796231 GTGAGCCACCACACCTGGCCAGG - Intronic
1104870700 12:131993305-131993327 GTGAGCCACCACACCTGGCCTGG + Intronic
1105414967 13:20203301-20203323 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1105966091 13:25386196-25386218 GTGAGCCACCTCTCCTGGCCGGG + Intronic
1106319330 13:28623733-28623755 GTGAGCCACCTCACCTGGCCAGG + Intergenic
1107036268 13:35905661-35905683 GTGAGCCACCACACCTGGCCTGG - Intronic
1107207567 13:37811878-37811900 GTGAGCCACCACACCTGGCCAGG - Intronic
1107848503 13:44545692-44545714 GTGAGCCAGCACGCCTGGCCTGG - Intronic
1108506930 13:51120729-51120751 GTGAGCCACCTCACCTATGACGG - Intergenic
1110213751 13:73003536-73003558 GTGAGCCACCGCACCTGGCCTGG + Intronic
1110237508 13:73232090-73232112 GTGAGCCACCACACCTAGCCTGG + Intergenic
1110451324 13:75640238-75640260 GTGAGCCACCGCACCTGGCCTGG + Intronic
1110475085 13:75904168-75904190 ATTAACCACCTCACCTCTCCTGG - Intergenic
1110565605 13:76954844-76954866 GTGAGCCACCACACCTGGCCTGG - Intronic
1110734746 13:78923156-78923178 ATGGGGCAGCTCATCTCTCCAGG + Intergenic
1111281321 13:86028985-86029007 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1111310690 13:86480405-86480427 GTGAGCCAGCGCACCTGGCCTGG - Intergenic
1112320557 13:98403316-98403338 GTGATCCTGCTCACCTCTAAGGG - Intronic
1112440658 13:99422397-99422419 GTGACTCAGCCCACCTCTCTGGG - Intergenic
1112643562 13:101304718-101304740 GTGAGCCACCACACCTGGCCTGG + Intronic
1112934127 13:104777992-104778014 GTGAGCCACCACACCTGGCCAGG + Intergenic
1113511974 13:110863652-110863674 GTGAGCGGCCTCTCCTCTCCAGG + Intergenic
1114094647 14:19322488-19322510 GTGAGCCACCGCACCTAACCGGG - Intergenic
1114855534 14:26436332-26436354 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1114891190 14:26925852-26925874 AAGACCCAGCTCACTTCTCCCGG + Intergenic
1115325865 14:32137688-32137710 GTGAGCCACCCCACCTGGCCCGG - Intronic
1115596629 14:34916024-34916046 GTGAGCCACCACACCTGGCCAGG + Intergenic
1115646992 14:35375400-35375422 GTGAGCCACCTCACCCGGCCTGG - Intergenic
1116723635 14:48533090-48533112 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1117011059 14:51471205-51471227 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1117180600 14:53187284-53187306 GTGAGCCACCACACCTGGCCTGG - Intergenic
1119144885 14:72303216-72303238 GTGAGCCACCACACCTGGCCTGG - Intronic
1119368129 14:74113108-74113130 GTGAGCCACCGCACCTGGCCAGG - Intronic
1119665145 14:76480139-76480161 GTGAGCCACCGCACCTGACCAGG + Intronic
1120848919 14:89151062-89151084 GTGAGCCACCTCACCCAGCCTGG - Intronic
1120944926 14:89985744-89985766 GTGAGCCACCACACCTGGCCAGG - Intronic
1120959295 14:90109988-90110010 GTGAACCACCTCACCTGGCCAGG + Intronic
1120985090 14:90327726-90327748 GTGAGCCACCTCGCCTAGCCTGG - Intronic
1120989152 14:90359919-90359941 GTGAGCCACCGCACCCCGCCTGG - Intergenic
1121055792 14:90851318-90851340 GTGAGCCACCGCACCTGGCCTGG + Exonic
1121081999 14:91115690-91115712 GTGAGCCACCACACCTAGCCAGG + Intronic
1121293839 14:92799887-92799909 GTGAGCCACCACACCTGGCCAGG + Intronic
1121322754 14:93002069-93002091 GTGAGCCACCACACCTGGCCAGG - Intronic
1121354771 14:93205385-93205407 GTGAGCCACCACACCTGGCCAGG - Intronic
1121798789 14:96756360-96756382 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1122229744 14:100299986-100300008 GTGAGCCACCACACCTGGCCAGG - Intronic
1122350225 14:101084708-101084730 GTGAGAAGGCTCATCTCTCCCGG - Intergenic
1122478076 14:102025833-102025855 GTGAGCCACCGCACCTGGCCTGG - Intronic
1202872088 14_GL000225v1_random:174470-174492 GTGAGCCAGCACACCCAGCCTGG - Intergenic
1124471570 15:29991809-29991831 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1124790507 15:32721470-32721492 GTGAGCCACCTCACCCGGCCAGG - Intronic
1125268352 15:37910420-37910442 GTGAGCCACCGCACCCGTCCAGG - Intergenic
1126000417 15:44204734-44204756 ATGAGCCACCTCACCTGGCCTGG - Intergenic
1126078725 15:44938128-44938150 ATGAGCCACCGTACCTCTCCTGG - Intergenic
1126172440 15:45705583-45705605 GTGAGCAAACTCACCTCAGCAGG - Intergenic
1126728124 15:51653996-51654018 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1126809399 15:52386032-52386054 GTGAGCCACCACACCTGGCCAGG - Intronic
1126813916 15:52436210-52436232 GTGAGCCACCACACCTGGCCTGG + Intronic
1127512088 15:59652890-59652912 CTGAGCCAGCTCACTTCTACAGG - Intronic
1128093301 15:64933559-64933581 GTGAGCCACCGCACCTGGCCAGG - Intronic
1128166175 15:65467108-65467130 GTCAGCCTTGTCACCTCTCCAGG + Exonic
1128307415 15:66608720-66608742 GTGAGCCACCTCAGCTGGCCTGG - Intronic
1128681580 15:69656292-69656314 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1128829153 15:70750582-70750604 GTGAGCCACCACACCTGGCCAGG - Intronic
1128861748 15:71080094-71080116 ATGAGCCACCTCACCCATCCTGG - Intergenic
1128941085 15:71788273-71788295 GTGAGCCACCGCACCTGGCCGGG + Intergenic
1129313447 15:74727381-74727403 GTGAGCCACCGCACCTGCCCAGG - Intergenic
1129420054 15:75417659-75417681 GTGAGCCACCACACCTGGCCAGG + Intronic
1129847714 15:78775586-78775608 GTGAGCGACTTCACCTCTCTGGG - Intronic
1129906964 15:79195279-79195301 GTGTGCCAGCTCACTGCTGCTGG - Intergenic
1129993670 15:79986455-79986477 GTGAGCCACCACACCTGGCCAGG - Intergenic
1130288883 15:82579177-82579199 GTGAGCCACCACACCTAGCCTGG - Intronic
1130345194 15:83037798-83037820 GTGAGCCACCGCACCTGGCCTGG - Intronic
1130736904 15:86559933-86559955 GTGAGCCACTTAACCTCTCTGGG + Intronic
1130929379 15:88411878-88411900 GTGAGCCACCGCACCTGACCAGG + Intergenic
1131174052 15:90199154-90199176 GTGAGCCACCACCCCTGTCCTGG + Intronic
1131174121 15:90199542-90199564 GTGAGCCACCACACCTGACCCGG - Intronic
1131429039 15:92371653-92371675 GTGAACCATGACACCTCTCCAGG - Intergenic
1131435588 15:92419102-92419124 GAGCCCCAGTTCACCTCTCCAGG + Intronic
1131475144 15:92732059-92732081 GTGAGCCAGTGCACCTGGCCTGG - Intronic
1133096636 16:3451633-3451655 GTGAGCCACCACACCTGGCCAGG - Intronic
1133110266 16:3543869-3543891 GTGAGCCACCACACCTGGCCTGG - Intronic
1133204138 16:4222809-4222831 GTGAGCCACCGCATCTCGCCAGG - Intronic
1133223692 16:4329992-4330014 GTGAGCCACCTCGCCCCACCTGG - Intronic
1133260130 16:4543922-4543944 GTGAGCCACCGCACCCCGCCAGG + Intergenic
1133288064 16:4700133-4700155 GTGAGCCACCACACCTGGCCTGG - Intronic
1133606511 16:7393154-7393176 GTGAGCCACCGCACCCCACCTGG + Intronic
1133940491 16:10305179-10305201 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1134271442 16:12736519-12736541 GTGAGCCACCGCACCTGGCCTGG + Intronic
1134775498 16:16849786-16849808 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1134837850 16:17376892-17376914 GTGAGCCACCACACCTGGCCTGG - Intronic
1135030025 16:19030853-19030875 GTGAGCCACCGCACCTAGCCTGG + Intronic
1135294884 16:21270564-21270586 GTGAGCCACCGCACCTAGCCAGG + Intronic
1135826696 16:25734934-25734956 GTGAGTCAGCTCACCCACCCTGG + Intronic
1136111596 16:28066883-28066905 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1136383983 16:29911403-29911425 GGGAGCCAGGCCACCTCCCCGGG + Intronic
1136520505 16:30792607-30792629 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1136544758 16:30948827-30948849 ATGAGTGGGCTCACCTCTCCTGG + Intergenic
1136582460 16:31161383-31161405 GTGAGCCACCTCATCTAGCCCGG - Intergenic
1136594556 16:31239152-31239174 GTGAGCCACCGCGCCTCACCAGG - Intergenic
1136686192 16:31996208-31996230 GTCTGCCAGGACACCTCTCCAGG - Intergenic
1136786804 16:32939737-32939759 GTCTGCCAGGACACCTCTCCAGG - Intergenic
1136882968 16:33914053-33914075 GTCTGCCAGGACACCTCTCCAGG + Intergenic
1138011350 16:53383619-53383641 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1138232169 16:55346260-55346282 GTGAGCCACCACACCTGGCCAGG + Intergenic
1138601299 16:58056233-58056255 GTGAGCCACCACACCTGGCCAGG - Intergenic
1139023404 16:62781715-62781737 GTTAGCCAGCTCAACTCTATGGG - Intergenic
1139356537 16:66370281-66370303 GTGAGCCACCACACCTGGCCAGG + Intronic
1139399753 16:66671881-66671903 GTGTGCCACCACACCACTCCTGG - Intronic
1139469926 16:67172809-67172831 GTGAGCCACCGCGCCTGTCCTGG - Intronic
1139684209 16:68590277-68590299 GTGAGCCACCTCACCTGGCCTGG - Intergenic
1139712790 16:68789312-68789334 GTGAGCCACCGCACCTGGCCAGG + Intronic
1139790024 16:69426422-69426444 GTGAGCCACCACACCTGGCCGGG - Intronic
1139827034 16:69765539-69765561 GTGAGCCACCGCACCTGGCCAGG - Intronic
1139921329 16:70462293-70462315 GTGAGCCACTACACCTGTCCTGG + Intronic
1140086101 16:71798603-71798625 GTGAGCCACCGCACCACGCCCGG - Intronic
1140229431 16:73105467-73105489 GTGAGCCAGCACGCCTGGCCTGG - Intergenic
1140391823 16:74593715-74593737 GTGAGCCACCACACCTGGCCAGG + Intronic
1140432864 16:74919623-74919645 GTGAGCCACCGCACCTGGCCTGG + Intronic
1141113383 16:81288545-81288567 GTGAGCCAGTGCACCTGGCCTGG + Intronic
1141628434 16:85273977-85273999 GTGAGCCACCACACCCATCCAGG + Intergenic
1141722626 16:85765282-85765304 GAGAGCCAGCTCACCTCCCCAGG + Intergenic
1141864049 16:86737631-86737653 GAGGGTCACCTCACCTCTCCTGG + Intergenic
1141962159 16:87416206-87416228 GTGAGCCACCGCACCTGGCCAGG + Intronic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1142184900 16:88690184-88690206 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1142310768 16:89312178-89312200 GTGAGCCACCGCACCTGGCCAGG + Intronic
1203089040 16_KI270728v1_random:1201407-1201429 GTCTGCCAGGACACCTCTCCAGG - Intergenic
1203141553 16_KI270728v1_random:1770622-1770644 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1142472869 17:172841-172863 GTGACCCACCTGACCTCTCTGGG - Intronic
1142543153 17:677835-677857 GTGAGCCACCACACCTGGCCTGG - Intronic
1142632739 17:1235948-1235970 GTGAGCCACCGCACCCCACCAGG + Intergenic
1142701645 17:1665876-1665898 GTGAGCCACCGCACCTGGCCTGG - Intronic
1142719623 17:1767422-1767444 GTGAGCCACCGCACCTGGCCAGG + Intronic
1142859144 17:2750133-2750155 GTGAGTCACATCACCTCTCTGGG + Intergenic
1142883258 17:2897052-2897074 GTGAGCCAGCGCACCTGGCCTGG - Intronic
1143018725 17:3905206-3905228 CTGAGCCAGCTCACCTGGGCTGG + Exonic
1143036591 17:4003189-4003211 GTGAGCCACCACACCTGGCCAGG + Intergenic
1143054802 17:4154852-4154874 GGGAGCCTGCTTACCTCTTCTGG - Exonic
1143262178 17:5607601-5607623 GTGAGCCACCGCACCTGGCCTGG + Intronic
1143293136 17:5848231-5848253 GTGAGCCACCGCACCTGGCCTGG - Intronic
1143369991 17:6433673-6433695 GTGGGCCAGCTCACTCCTGCTGG + Intronic
1143507491 17:7375996-7376018 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1143699911 17:8650702-8650724 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1143907133 17:10217861-10217883 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1143987795 17:10930112-10930134 GTGAGCCACCGCACCTGGCCGGG + Intergenic
1144101563 17:11946379-11946401 GTGAGCCACCACACCTGGCCGGG - Intronic
1144147057 17:12408951-12408973 GTGAGCCACCACACCTGACCTGG + Intergenic
1144344617 17:14338723-14338745 GTGAGCCAGCACACCCAGCCTGG + Intronic
1144526190 17:15992207-15992229 GTGAGCCACCGCACCTGGCCAGG + Intronic
1144752334 17:17657808-17657830 CTGAGCCTGCTCACCCCTCCTGG + Intergenic
1144866645 17:18339840-18339862 GCGAGCCACCTCACCTGGCCGGG + Intronic
1144970345 17:19105085-19105107 GTGAGCCACCTCAGCTGGCCTGG + Intergenic
1144990650 17:19231248-19231270 GTGAGCCACCTCAGCTGGCCTGG + Intronic
1145040369 17:19573663-19573685 GTGAGCCACCACACCTGGCCTGG + Intronic
1145055459 17:19700881-19700903 GTGAGCCACCGCACCTGGCCTGG - Intronic
1145201965 17:20953695-20953717 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1146114479 17:30122684-30122706 GTGAGCCACCACACCTGGCCTGG + Intronic
1146137850 17:30338797-30338819 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1146198532 17:30833962-30833984 GTGAGCCACCGCACCTGGCCTGG + Intronic
1146229144 17:31093558-31093580 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1146315734 17:31805563-31805585 GTGAGCCACCTCGCCTGGCCGGG + Intergenic
1146674220 17:34761686-34761708 GGGAGCCACTTCACCTCTCCAGG + Intergenic
1147147153 17:38491876-38491898 GTCTGCCAGGACACCTCTCCAGG - Intronic
1147190851 17:38737178-38737200 GTGAGCCACCGCACCTAGCCAGG - Intronic
1147259685 17:39201852-39201874 GTGAGCCACCACACCTAGCCTGG + Intronic
1147464962 17:40603776-40603798 GTGAGCCACCACACCTGGCCTGG - Intergenic
1147471890 17:40670234-40670256 ATGAGCCAGCGCACCTGGCCTGG - Intergenic
1148071005 17:44908445-44908467 GTGAGCCACCGCACCCCTCCTGG - Intronic
1148380316 17:47192070-47192092 GTGAGCCACCTCACCCAGCCAGG - Intergenic
1148388831 17:47255259-47255281 GTGAGCCACCGCACCTGGCCAGG + Intronic
1148832189 17:50440835-50440857 GTGAGCCAGCTCACCTCTCCTGG - Intronic
1148841533 17:50501702-50501724 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1149442519 17:56686738-56686760 GTGAGCCACCGCACCTGCCCAGG - Intergenic
1149738850 17:59023929-59023951 GTGAGCCACCACACCTGGCCTGG - Intronic
1149904112 17:60509518-60509540 GTGAGCCACCACACCTGGCCAGG - Intronic
1149942082 17:60881254-60881276 GTGAGCCACCGCACCTGGCCTGG + Intronic
1149946346 17:60931788-60931810 GTGAGCCAGTGCACCTGGCCAGG - Intronic
1149987200 17:61356274-61356296 GTGAGCCACCGCACCTGGCCAGG + Intronic
1150909043 17:69369184-69369206 GTGAGCCATCGCACCTAGCCTGG - Intergenic
1150932843 17:69603892-69603914 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1151378120 17:73705499-73705521 GTGGGTCATTTCACCTCTCCGGG + Intergenic
1151481292 17:74371438-74371460 GTGAGCCACCACACCTGGCCAGG + Intronic
1151483221 17:74382607-74382629 GTGAGCCAGCACACCCCGCCAGG + Intergenic
1151535180 17:74735255-74735277 GTGAGCCACCGCACCTGGCCTGG - Intronic
1151578061 17:74962833-74962855 GCCAGGCAGCTCAGCTCTCCTGG + Intronic
1152123278 17:78431887-78431909 GTGAGCCACCGCACCTGGCCAGG - Intronic
1152422106 17:80199208-80199230 GTGAGCCACCACACCTGGCCAGG - Intronic
1152537579 17:80959597-80959619 GGGAGCCAGATGACCCCTCCTGG + Intronic
1152655206 17:81516124-81516146 GTGAGCCACCTCACCCAGCCTGG + Intronic
1152676143 17:81642354-81642376 AGGAGCCAGCGAACCTCTCCCGG + Exonic
1152691073 17:81717903-81717925 GCGAGTCCCCTCACCTCTCCGGG + Intronic
1152948170 17:83209793-83209815 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1153033760 18:739105-739127 GTGAGCCACCGCACCTGGCCTGG + Intronic
1153128066 18:1819615-1819637 GTGAGCCACTGCACCTGTCCTGG + Intergenic
1153238081 18:3007451-3007473 GTAAGCCACCACACCTATCCAGG + Intronic
1153616991 18:6944296-6944318 GTGAGCCACCGCACCTGGCCCGG + Intronic
1153740599 18:8123014-8123036 GTGAACAAGCTCACTTCTCTTGG - Intronic
1154999629 18:21673885-21673907 GTGAGCCATCACACCTGGCCAGG + Intronic
1155261294 18:24044984-24045006 GTGAGCCACCGCACCTGGCCCGG - Intronic
1155373220 18:25126903-25126925 ATAAGCCATCTGACCTCTCCAGG + Intronic
1155405329 18:25481383-25481405 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1155464807 18:26122316-26122338 GTAAGCCACCTCACCTGGCCTGG - Intergenic
1156091591 18:33478459-33478481 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1156426562 18:37019834-37019856 CTGAGCCACCTTACCTTTCCTGG - Intronic
1156713902 18:39982875-39982897 GTGAGCCACCGCACCCCGCCAGG + Intergenic
1157045173 18:44094285-44094307 GTGAGCCACCACACCTGGCCAGG - Intergenic
1157263949 18:46200586-46200608 GTGAGCCACCGCACCTGGCCAGG + Intronic
1157401361 18:47391206-47391228 GTGAGCCACCACACCTGACCAGG - Intergenic
1157847226 18:51015257-51015279 GTGAGCCACCACACCTGGCCCGG - Intronic
1157963552 18:52182979-52183001 GTGAGCCACCACACCTGGCCGGG + Intergenic
1158337683 18:56431747-56431769 CTCACCCAGCTGACCTCTCCTGG - Intergenic
1158458454 18:57627488-57627510 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1158892641 18:61887434-61887456 GTGAGCCACCGCACCTAGCCAGG - Intronic
1159022860 18:63157230-63157252 GACAGGCAGTTCACCTCTCCGGG - Intronic
1159045007 18:63361532-63361554 GTGAGCCACCACACCTGGCCTGG - Intronic
1159190660 18:65037267-65037289 GTGAGCCACCTCACCCAGCCCGG + Intergenic
1159527045 18:69605987-69606009 GTGAGCCACCGCACCTGGCCGGG - Intronic
1160698768 19:496676-496698 CTGAGCCCCCTCCCCTCTCCTGG - Intronic
1160728988 19:632215-632237 GTGAGCCACCGCACCTGGCCAGG + Intronic
1161139458 19:2638953-2638975 GTGAGCCACCGCACCTGGCCAGG - Intronic
1161387489 19:4003888-4003910 GTGAGCCACCACACCTGGCCAGG - Intergenic
1161438000 19:4275279-4275301 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1161457818 19:4378430-4378452 GTGAGCCACCGCACCTGGCCTGG - Intronic
1161491755 19:4566209-4566231 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1161599388 19:5171915-5171937 ATGAGCCAGCACACCTGACCTGG - Intronic
1161647923 19:5465755-5465777 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1161853659 19:6751997-6752019 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1161901260 19:7121279-7121301 GTGAGCCACCGCACCTGGCCAGG + Intronic
1161976260 19:7609441-7609463 GTGAGCCACCACACCTGGCCCGG + Intronic
1162055994 19:8064458-8064480 GTGAGCCACCACACCCCGCCAGG + Intronic
1162074434 19:8175904-8175926 GTGAGCCACCGCACCTGGCCTGG - Intronic
1162137931 19:8567637-8567659 GTGAGCCACCGCACCCATCCTGG + Intronic
1162377390 19:10312817-10312839 GTGAGCCACCACACCTTGCCAGG + Intronic
1162380360 19:10328279-10328301 GTGAGCCACCACACCTGGCCAGG - Intronic
1162399783 19:10438391-10438413 GTGAGCCACCACACCTGGCCAGG + Intronic
1162407417 19:10483585-10483607 GTGAGCCACCCCACCTGGCCCGG + Intergenic
1163392231 19:17037635-17037657 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1163397393 19:17071712-17071734 GTGAGCCACCGCACCTAGCCAGG - Intronic
1163454343 19:17397548-17397570 ATGAGCCAGCTCGCCTGGCCTGG - Intergenic
1163626081 19:18390555-18390577 GTGAGCCTGCTCCCATCTCAGGG - Intergenic
1163735014 19:18974509-18974531 GTGAGCCACCACACCTGACCTGG + Intergenic
1163757527 19:19115239-19115261 GTGAGCCACCACACCTGGCCTGG + Intergenic
1164566079 19:29327025-29327047 CTGAGCCAGCACACCTGGCCAGG + Intergenic
1164774209 19:30839199-30839221 GTGAGCCACCTCTCCTGACCAGG - Intergenic
1165022946 19:32938664-32938686 GTGAGCCACCACACCTGGCCTGG - Intronic
1165132259 19:33640389-33640411 GTGGCTCAGCCCACCTCTCCAGG + Intronic
1165179314 19:33954218-33954240 GTGAGCCACCACACCTGGCCTGG - Intergenic
1165191600 19:34068275-34068297 GTGAGCCACCTCACCTGGCCTGG - Intergenic
1165200107 19:34136596-34136618 GTGAGCCACCACACCCCGCCAGG - Intergenic
1165498854 19:36171603-36171625 GTGAGCCACCACACCTGGCCAGG - Intergenic
1165553729 19:36610994-36611016 GTGAGCCACCTCACCTGGCCAGG - Intronic
1165943560 19:39427918-39427940 GTGAGCCACCGCACCTGGCCAGG - Exonic
1166355024 19:42221944-42221966 GTGAGCCACCACACCTGGCCTGG + Intronic
1166703330 19:44894708-44894730 GTGAGCCACCTCGCCTGGCCAGG + Intronic
1166746206 19:45143009-45143031 GTGACCCACCCCACCCCTCCAGG - Intronic
1166779900 19:45336336-45336358 GTGAGCCACCACACCTGGCCAGG - Intronic
1166859387 19:45801078-45801100 GTGAGCCACCTCGCCTGGCCTGG + Intronic
1167275175 19:48533668-48533690 GTGAGCCACCACACCACGCCCGG + Intergenic
1167287364 19:48606026-48606048 GTGAGCCACCACACCACGCCTGG - Intronic
1167540654 19:50085308-50085330 GTGAGCCACCACACCTGGCCTGG - Intergenic
1167629062 19:50612505-50612527 GTGAGCCACCACACCTGGCCTGG + Intergenic
1167797297 19:51717953-51717975 GTGAGCCACCACACCTGGCCTGG - Intronic
1168095204 19:54110442-54110464 GTGAGCCACCGCACCTGGCCTGG - Intronic
1168359647 19:55728292-55728314 GTGAGCCACCGCACCTGGCCTGG - Intronic
1168377307 19:55891220-55891242 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1168687049 19:58355225-58355247 GTGAGCCACCGCACCTGGCCAGG - Exonic
925062224 2:901779-901801 GTGAGCCACCGCACCTGGCCAGG - Intergenic
925551657 2:5082441-5082463 GTGAGCCACCACACCTGGCCTGG + Intergenic
925569522 2:5294146-5294168 GTGAGTCACTTCACCTCTCTTGG + Intergenic
925729125 2:6904800-6904822 GTGAGCCACCACACCTGGCCAGG + Intergenic
925954993 2:8954792-8954814 CTGAGCCACCCCACCCCTCCTGG - Intronic
926270519 2:11362158-11362180 GTGAGCCACCGCACCTGGCCAGG + Intergenic
926713398 2:15902477-15902499 GTGAGCCAGCACGCCTGGCCTGG - Intergenic
926867906 2:17379908-17379930 GTGTGTCAGTTAACCTCTCCAGG - Intergenic
926890112 2:17632149-17632171 GTGAGCCACCACACCTGGCCAGG + Intronic
926982215 2:18584491-18584513 GTGAGCCAGCCCGCCGCCCCTGG - Intronic
927012029 2:18913984-18914006 GTGAGCCACCGCACCTGGCCAGG - Intergenic
927547394 2:23966415-23966437 GTGAGCCACCGCACCTGGCCTGG + Intronic
927548165 2:23973299-23973321 GTGAGCCACCGCACCTGGCCTGG + Intronic
927721167 2:25383499-25383521 GTGAGCCACCGCACCTGGCCTGG + Intronic
927743364 2:25591776-25591798 GTGAGCCAGTGCACCTGGCCGGG - Intronic
927756588 2:25713360-25713382 GTGAGCCACCGCACCTGGCCTGG - Intergenic
927757266 2:25719095-25719117 GTAAGCCAGCTCCCTTGTCCAGG + Intergenic
927963952 2:27257827-27257849 GAGAGCCAGCTCTCCCATCCTGG + Intronic
927974165 2:27325366-27325388 GTGAGCCACCACACCTGGCCAGG + Intronic
928975924 2:37086510-37086532 GTGAGCCACCACACCTGGCCTGG - Intronic
929694847 2:44105750-44105772 GTGAGCCACCGCACCTGGCCCGG + Intergenic
929695671 2:44113202-44113224 GTGAGCCACCACACCTGGCCAGG - Intergenic
929831297 2:45348943-45348965 GTGAGCCACCTCGCCTGGCCTGG - Intergenic
930115449 2:47714321-47714343 GTGAGCCACCACACCTGGCCTGG - Intronic
930181050 2:48357716-48357738 GTGAGCCACCGCACCTGGCCTGG + Intronic
930195690 2:48507647-48507669 GTGAGCCACCTCGCCTGGCCCGG + Intronic
930258917 2:49122757-49122779 GTGAGCCAGCCCTCTTCACCAGG - Intronic
930754567 2:54961467-54961489 GTGAGCCATCACACCTGGCCAGG + Intronic
931362420 2:61589194-61589216 GTGAGCCACCACACCTGGCCTGG + Intergenic
931725293 2:65104058-65104080 GTGAGCCACCGCACCTGGCCAGG + Intronic
932326647 2:70866890-70866912 GTGAGCCACTTCACCTAGCCAGG - Intergenic
932506816 2:72241922-72241944 GTGAGCCACCACACCTGGCCAGG - Intronic
932545155 2:72701059-72701081 GTGAGCCACCGCACCTGGCCAGG - Intronic
932615958 2:73231735-73231757 GTGAGCCACCGCACCTGCCCTGG + Intronic
932677075 2:73790992-73791014 GTGAGCCACCGCACCCCGCCTGG - Intronic
932677660 2:73795889-73795911 GTGAGCCACCGCACCCCGCCTGG - Intronic
932678246 2:73800787-73800809 GTGAGCCACCGCACCCCGCCTGG - Intronic
932678832 2:73805687-73805709 GTGAGCCACCGCACCCCGCCTGG - Intronic
932748152 2:74352290-74352312 GTGAGCCACCACACCTGGCCTGG + Intronic
933775826 2:85770662-85770684 GAAAGCCAGCTCAGCTCACCTGG - Intronic
934909635 2:98239630-98239652 GTGAGCCACCGCACCTGGCCAGG - Intronic
935158857 2:100511520-100511542 GTGAGCCACCGCACCTGGCCAGG - Intergenic
935169587 2:100600728-100600750 GTGAGCCACCGCACCTGGCCTGG - Intergenic
935647700 2:105354380-105354402 GTGAGCCACCACACCTGGCCAGG - Intergenic
936150997 2:110022477-110022499 GTGAGGCAGCCCACCTGTCCAGG + Intergenic
936193679 2:110348892-110348914 GTGAGGCAGCCCATCTGTCCAGG - Intergenic
936694120 2:114927129-114927151 GTGAGCCACCGCACCTGGCCAGG + Intronic
936939201 2:117866107-117866129 GTGAGCCACCACACCTGGCCTGG - Intergenic
937290857 2:120780953-120780975 GTGAGCCAGCTCACAGCCCCAGG - Intronic
937460059 2:122077848-122077870 GTGAGCCACCTCACCTGCCGGGG - Intergenic
937956277 2:127423267-127423289 TTGAGGAAGCTCACCTCTGCGGG - Exonic
938251519 2:129819441-129819463 GTGAGCCAGCACACCCAACCAGG + Intergenic
938485251 2:131700142-131700164 GTGAGCCACCGCACCTAGCCGGG + Intergenic
938698351 2:133854686-133854708 GTGGGCCTGCCCACTTCTCCGGG + Intergenic
939185714 2:138858160-138858182 GTGAGCCACCGCACCTAGCCTGG + Intergenic
939378913 2:141408424-141408446 GTGAGCCACCACACCTGGCCAGG + Intronic
939822731 2:146977171-146977193 GTGAGCCACCACACCTGGCCTGG + Intergenic
940417931 2:153443638-153443660 GTGAGCCACCGCACCTGGCCTGG - Intergenic
941844404 2:170119069-170119091 GTGTGCGAGATCATCTCTCCTGG + Intergenic
942093788 2:172519044-172519066 GTGTGCAAGATCATCTCTCCTGG + Intergenic
942947804 2:181688353-181688375 GTGAGCCACCGCACCTGGCCTGG + Intergenic
943189517 2:184658199-184658221 GTGAGCCACCACACCTGGCCTGG - Intronic
943269195 2:185775943-185775965 GTGAGCCATCGCACCTGGCCAGG + Intronic
943300456 2:186191362-186191384 GTGAGCCACCACACCTGACCTGG - Intergenic
944678983 2:202059316-202059338 GTGAGCCACCACACCTGTCCTGG - Intergenic
944761846 2:202824118-202824140 GTGAGCCACTGCACCTCGCCAGG - Intronic
944874729 2:203950777-203950799 GTGAGCCACCGCACCTGGCCTGG - Intronic
945066987 2:205955863-205955885 GTGAGCCACCACACCTGGCCAGG + Intergenic
945084616 2:206118667-206118689 GTGAGCCAGCGCACCCAGCCTGG - Intronic
946001893 2:216489226-216489248 GTGAGCCACCACACCCCGCCTGG + Intergenic
946200689 2:218069194-218069216 GTGAGCCAGGTTCCCCCTCCAGG + Intronic
946311798 2:218886148-218886170 TTGCACCAGCTCACCTCTCTGGG - Intronic
946551123 2:220803085-220803107 GTGAGCCACCACACCTGGCCAGG - Intergenic
947508385 2:230727954-230727976 GTGAGCCACCACACCTGGCCTGG - Intronic
947617767 2:231569252-231569274 GGGAGCCAGCTCTCCTCCCCTGG - Intergenic
947753894 2:232547122-232547144 GTGAGCCACCACACCTGGCCAGG - Intergenic
947963425 2:234259138-234259160 GTGAGCCACCTCGCCTGGCCTGG - Intergenic
948157029 2:235791827-235791849 GTGAGCCAGCTCACCCAGCCGGG + Intronic
948284951 2:236776786-236776808 CTCTGCCAGGTCACCTCTCCTGG + Intergenic
948462273 2:238135801-238135823 GTGAGTGAGCTCCCCTCTGCTGG + Intergenic
948600373 2:239104510-239104532 GTGAGCCACCGCACCTGGCCAGG + Intronic
949012810 2:241691090-241691112 GTGAGCCAGCGCACCCAGCCAGG + Intergenic
1168787567 20:553002-553024 GTGAGCCACCACACCTGGCCTGG + Intergenic
1168960347 20:1864776-1864798 GTGAGCTACTTCACCTCCCCTGG + Intergenic
1169454320 20:5738729-5738751 GTGAGCCACCACATCTGTCCAGG + Intergenic
1169508071 20:6234372-6234394 GGGAGCCCGCTCACCTCTTGTGG + Intergenic
1169572165 20:6918206-6918228 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1169590494 20:7135785-7135807 GTGAGCCACCGCACCTGTCCTGG + Intergenic
1170178744 20:13503325-13503347 GATAGCCAGCTCAACTCTGCAGG + Intronic
1170178859 20:13505455-13505477 GATAGCCAGCTCAACTCTGCAGG + Intronic
1170850098 20:19996879-19996901 GTGAGCCAGCTCCGCATTCCTGG - Intronic
1171143544 20:22763284-22763306 GTGTGTCAGCTCAACTCACCAGG + Intergenic
1171159351 20:22907387-22907409 GTGAGCCACCACACCTGGCCTGG + Intergenic
1171391466 20:24804115-24804137 ATGAGCCACCTCACCTGGCCCGG + Intergenic
1171408339 20:24928874-24928896 GTGAGCCAGCTGTCCTCAGCTGG - Intergenic
1171419585 20:25008874-25008896 CCCAGCCAGCTCACCTGTCCAGG - Intronic
1171419594 20:25008921-25008943 CTCAGCCAGCTCACCTGTCCAGG - Intronic
1171479596 20:25443762-25443784 GTGAGCCACCGCACCTGGCCTGG + Intronic
1172137287 20:32695669-32695691 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1172137410 20:32696491-32696513 GTGAGCCACCACACCTGGCCTGG + Intergenic
1172317506 20:33967512-33967534 GTGAGCCACCCCACCTGGCCAGG - Intergenic
1172648537 20:36486892-36486914 GTGAGCCACCTCACCCGGCCTGG + Intronic
1173163867 20:40672272-40672294 CTGGGCCAGCTGAGCTCTCCTGG + Intergenic
1173591320 20:44227310-44227332 GTGAGCCACCACACCTGGCCTGG + Intergenic
1173815353 20:45984217-45984239 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1174351023 20:49968093-49968115 GTGAGCCACCTCACCCGGCCTGG + Intergenic
1174378914 20:50143977-50143999 GTGAGCCACCGCACCTGGCCAGG + Intronic
1174437997 20:50525341-50525363 GTGAGCCACCGCACCTGGCCTGG + Intronic
1174808883 20:53628928-53628950 GTGAGCCACCTCACCCGGCCAGG + Intergenic
1174820107 20:53719303-53719325 GTGAGCCACCTCACCAGGCCTGG - Intergenic
1175392288 20:58635091-58635113 GTGAGGCAGCCCCCCACTCCTGG - Intergenic
1175684461 20:61017534-61017556 GTGAGCCACCACACCTGGCCTGG + Intergenic
1176149830 20:63584771-63584793 GTGAGCCACCACGCCTCGCCCGG - Intergenic
1176172657 20:63703126-63703148 CTGTGCCAGCTCTCCTGTCCAGG + Intronic
1176229130 20:64022588-64022610 GTGAGCCACCGCACCTGGCCTGG + Intronic
1176423019 21:6531569-6531591 GTGAGCCACCACACCTGTTCTGG - Intergenic
1177012438 21:15744868-15744890 GTGAGCCACCGCACCCCGCCGGG + Intronic
1177158368 21:17521603-17521625 GTGAGCCACCGCACCTGGCCAGG + Intronic
1177608746 21:23418661-23418683 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1178092985 21:29183840-29183862 GTGAGCCACCTCACCCGGCCAGG + Intergenic
1178315481 21:31563138-31563160 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1178468065 21:32866756-32866778 GTGAGCCACCACACCCATCCTGG + Intergenic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1178906857 21:36643650-36643672 GTGAGCCAGCACACCTGGCTGGG + Intergenic
1179031706 21:37726186-37726208 GTGAGCCACCACACCTGGCCAGG + Intronic
1179449588 21:41459513-41459535 GTGAGCCATCGCACCTGGCCTGG - Intergenic
1179698513 21:43139885-43139907 GTGAGCCACCACACCTGTTCTGG - Intergenic
1179918592 21:44494581-44494603 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1180004537 21:45014211-45014233 GTGAGCCACCACACCTGGCCTGG + Intergenic
1180110920 21:45650044-45650066 GTGAGCCACCACACCTGGCCTGG - Intronic
1180286008 22:10745022-10745044 GTGAGCCAGCACACCCAGCCTGG + Intergenic
1180486085 22:15800108-15800130 GTGAGCCACCGCACCTAACCGGG + Intergenic
1180670655 22:17549906-17549928 ATGAGCCAGCACACCTGGCCTGG + Intronic
1180686248 22:17669312-17669334 GTGAGCCACCGCACCTGGCCTGG + Intronic
1181012119 22:20047515-20047537 GTGAGCCACCTCACCCAGCCCGG + Intronic
1181314316 22:21961840-21961862 GTGAGACATCTCACAGCTCCAGG + Intronic
1181499621 22:23308585-23308607 GTGAGCCACCGCACCTGGCCAGG + Intronic
1181576740 22:23800109-23800131 GTGAGCCACCGCACCTGGCCTGG + Intronic
1181658372 22:24319945-24319967 GTGAGCCACCGCACCTGGCCAGG - Intronic
1181809382 22:25394130-25394152 GTGAGCCACCACACCTGGCCTGG - Intronic
1182170955 22:28228872-28228894 GTGAGCCACCACGCCTCGCCGGG - Intronic
1182629490 22:31674053-31674075 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1182662603 22:31935617-31935639 GTGAGCCATCGCGCCTGTCCGGG - Intronic
1183012491 22:34958302-34958324 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1183223223 22:36530629-36530651 GTGAGCCACCACACCTGACCAGG + Intergenic
1183238422 22:36637735-36637757 GTGAGCCACCGCACCTGGCCAGG - Intronic
1183378661 22:37479719-37479741 GTGAGCCACCACACCTGGCCAGG - Intronic
1183562255 22:38584480-38584502 GTGAGCCACCACACCTGGCCTGG - Intronic
1183869773 22:40732426-40732448 GTGAGCCACCACACCTGGCCTGG + Intergenic
1183917975 22:41138444-41138466 GTGAGCCACCACGCCTGTCCTGG + Intronic
1184083453 22:42242602-42242624 GTGAGCCACCTCGCCTGGCCGGG - Intronic
1184162532 22:42705718-42705740 GTGAGCCACCGCACCTGGCCTGG - Intronic
1184347090 22:43920356-43920378 GTGAGCCACCTCGCCTGTCCAGG - Intergenic
1184474572 22:44713513-44713535 GTGAGCCAGCGCACCTGGCCTGG + Intronic
1184494323 22:44828728-44828750 GTCAGCCAGCACACCTAGCCCGG + Intronic
1184565501 22:45289292-45289314 GTGAGCCACCACACCTGGCCTGG - Intronic
1184588338 22:45462858-45462880 GTGAGCCACCACACCTGGCCTGG + Intergenic
1184591929 22:45490720-45490742 GTGAGCCACCTCACCCGGCCTGG + Intergenic
1184615328 22:45634119-45634141 GTGAGCCACCACACCTGGCCGGG + Intergenic
1184850772 22:47118867-47118889 GTGAGCCACCGCACCTGGCCAGG - Intronic
1184878483 22:47290343-47290365 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1185032977 22:48454699-48454721 GTGAGCCAACTAACCTCCCAGGG - Intergenic
1185311190 22:50155754-50155776 GTGAGCCACCGCACCCCGCCTGG + Intronic
949321051 3:2811125-2811147 GTGAGCCACCGCACCTGGCCGGG - Intronic
949344633 3:3065489-3065511 GTGAGCCACCGCACCTGGCCTGG - Intergenic
949399709 3:3653324-3653346 GTGAGCCACCACGCCACTCCCGG - Intergenic
949470628 3:4392108-4392130 GTGAGCCACTGCACCTGTCCTGG + Intronic
949511361 3:4769909-4769931 GTGCTCCAGCACACTTCTCCTGG - Intronic
949923792 3:9024666-9024688 GGGAACTAGGTCACCTCTCCAGG + Intronic
950290629 3:11781450-11781472 GTGAGCCACCGCACCTGACCGGG - Intergenic
950544512 3:13630495-13630517 CTCAGCCAACTCACCTCACCAGG - Intronic
950581168 3:13863009-13863031 ATGAGCTAACTCACCTCTCAAGG + Intronic
950706341 3:14784784-14784806 GTGAGCCACCGCACCTGGCCTGG - Intergenic
950776289 3:15353148-15353170 GTGAGCCATGTCACCTGGCCAGG + Intergenic
950835312 3:15913662-15913684 ATGAGCCACCTCACCTGGCCTGG + Intergenic
950949602 3:16984648-16984670 GTGAGCCAGCGCACCTGGCCAGG - Intronic
952069953 3:29622834-29622856 GTGAGCCACCGCTCCTGTCCGGG - Intronic
952440326 3:33320759-33320781 GTGAGCCACCACACCTAGCCAGG + Intronic
952619264 3:35316712-35316734 GTGAGCCACCACACCTGGCCTGG - Intergenic
952766568 3:36959382-36959404 GTGAGCCATCGCACCTGGCCAGG - Intergenic
952777912 3:37064307-37064329 GTGAGCCACCACACCTGGCCTGG - Intronic
953036127 3:39212410-39212432 GTGAGCCACCACGCCTGTCCAGG + Intergenic
953229458 3:41051760-41051782 GTCAGCCATCTCACAGCTCCTGG - Intergenic
953723749 3:45379810-45379832 GTGAGCCACCACACCTGGCCAGG + Intergenic
953965959 3:47307353-47307375 GTGAGCCACCACACCTGGCCTGG + Intronic
954081511 3:48214833-48214855 GTGAGCCACTGCACCTGTCCTGG + Intergenic
954103122 3:48393276-48393298 GTGAGCCATCACACCTGGCCTGG + Intronic
954737326 3:52717122-52717144 GTGAGCCAACACACCTGGCCTGG - Intronic
955019455 3:55105209-55105231 GTGAGCCACTTCACTTCTCTGGG + Intergenic
955323916 3:57995051-57995073 ATGAGCCACCTCACCTGGCCTGG - Intergenic
955407146 3:58632772-58632794 GTGAGCCACCGCACCTGGCCTGG + Intergenic
956031682 3:65044399-65044421 GTGAGCCAGCGCGCCTAGCCAGG + Intergenic
956566025 3:70639589-70639611 GTGAGCCACCACACCTGGCCTGG + Intergenic
956675480 3:71728453-71728475 GTAAGTCACCTCACCTCTCTGGG - Intronic
956745994 3:72311382-72311404 GTGACCCAAGTCCCCTCTCCAGG + Intergenic
957049391 3:75399638-75399660 GTGAGCCACCACACCTGGCCGGG - Intergenic
958946641 3:100369781-100369803 GTGAGCCACCGCACCTGGCCAGG + Intronic
960083757 3:113568849-113568871 GTGAGCCACCGCACCTGGCCTGG - Intronic
960136613 3:114112061-114112083 GTGAGCCACCGCACCTGGCCTGG + Intergenic
960137386 3:114119521-114119543 GTGAGCCACCGCACCTGGCCTGG + Intergenic
960346020 3:116534294-116534316 GAAAGCCTGCTCACCTCTACAGG + Intronic
960676746 3:120202731-120202753 GTGAGCCACCTCTCCTGGCCAGG + Intronic
960895224 3:122496984-122497006 GTGAGCCACTTCACCTGGCCAGG + Intronic
961042590 3:123687945-123687967 GTGAGCCACCACACCTGGCCTGG + Intronic
961402695 3:126658216-126658238 GTGCCCCTGCTCCCCTCTCCCGG - Intergenic
961737317 3:129010410-129010432 GAGAGCCAGCTCAGCTCAGCCGG + Intronic
962199179 3:133387601-133387623 TTGAGCAAGTTCACCTCTCTAGG + Intronic
962517094 3:136162298-136162320 GTGAGCCACCACACCTGGCCTGG - Intronic
963085021 3:141428366-141428388 GTGAGGCAAGTCACTTCTCCAGG + Intronic
963812221 3:149789054-149789076 GTGAGCCACCACACCTGGCCAGG + Intronic
964169574 3:153753875-153753897 GTGAGCCACCACACCTGGCCTGG - Intergenic
964171218 3:153771755-153771777 GTGAGCCACCGCACCTGGCCTGG - Intergenic
965523571 3:169693086-169693108 GTGAGCCACCGCACCTGGCCAGG - Intergenic
965692060 3:171367750-171367772 GTGAGCCACCGCACCTGGCCAGG + Intronic
965725546 3:171711449-171711471 GTGAGCCACCGCACCTGGCCAGG + Intronic
965792938 3:172409259-172409281 GTGAGCCACCACACCTGGCCAGG - Intergenic
967060009 3:185863891-185863913 GTGAGCCACCACACCTGGCCAGG - Intergenic
967101807 3:186221885-186221907 GGGAGCCAGCTGAGCTCTGCCGG + Intronic
967168487 3:186805502-186805524 GTGAGCCATCTCGCCTGGCCAGG + Intronic
967387959 3:188928926-188928948 GTGAGCCACCACACCTGGCCTGG - Intergenic
967847716 3:194057309-194057331 GTGAGCCATCACACCTGGCCAGG - Intergenic
967965560 3:194957451-194957473 GTGAGCCACCACACCTGACCAGG - Intergenic
967989954 3:195123338-195123360 GTCAGCAAGCCCCCCTCTCCTGG + Intronic
968021242 3:195391710-195391732 GTGAGCCATCGCACCTGGCCTGG - Intronic
968147308 3:196310392-196310414 GTGAGCCACCGCACCTGGCCAGG + Intronic
968994002 4:3934028-3934050 GTGAGCCACCACACCTGGCCGGG - Intergenic
969512242 4:7625345-7625367 GTGGGTCATCTCACCACTCCAGG + Intronic
969597954 4:8159430-8159452 GTGAGCCGCGCCACCTCTCCCGG - Intergenic
969665826 4:8557120-8557142 GTGAGCCACCCCGCCTGTCCGGG + Intergenic
969677801 4:8624294-8624316 GTGAGCCACCGCACCTGGCCCGG - Intergenic
969678756 4:8629935-8629957 GTGAGCCACCGCACCTGGCCCGG - Intergenic
969679712 4:8635577-8635599 GTGAGCCACCGCACCTGGCCCGG - Intergenic
969822202 4:9729367-9729389 GTGAGCCACCACACCTGTCCAGG + Intergenic
970132335 4:12885439-12885461 GTCAGCCTGCTCACGTATCCGGG + Intergenic
970406653 4:15770420-15770442 GTGAGCCACCACACCTGGCCCGG - Intergenic
970609263 4:17710041-17710063 GTGAGCCACCGCACCTGGCCTGG - Intronic
971155006 4:24072503-24072525 ATGAGCAAGCTCTCCTCTCTAGG + Intergenic
972305067 4:37823159-37823181 GTGAGCCACCACACCTGGCCAGG - Intergenic
972470045 4:39395484-39395506 GTGAGCCACCTCGCCCCGCCTGG + Intergenic
972524578 4:39896004-39896026 GTGAGCCACCACACCTGGCCCGG + Intronic
972545142 4:40073001-40073023 GTGAGCCACCGCACCTGGCCAGG + Intronic
972787758 4:42343591-42343613 GTGAGCCATCACACCTGGCCAGG - Intergenic
972876440 4:43366728-43366750 GTGAGCCACCTCGCCTGGCCGGG + Intergenic
973077419 4:45947094-45947116 GTGAGCCACCTCGCCTGGCCGGG - Intergenic
973622397 4:52740756-52740778 GTGAGCCACCGCACCTGGCCTGG - Intronic
973803807 4:54504373-54504395 GTGAGCCAGTGCACCTGGCCAGG + Intergenic
974874242 4:67683788-67683810 GTGAGCCACCACAACTGTCCTGG - Intronic
975201028 4:71589816-71589838 GTGAGCCACCGCACCCCACCTGG + Intergenic
975310408 4:72897877-72897899 GTGAGCCACCGCACCTGGCCAGG + Intergenic
975494580 4:75023987-75024009 GTGAGCCACCGCACCTGGCCAGG - Intronic
976150476 4:82086426-82086448 GTGAGCCACCGCACCTGGCCGGG - Intergenic
976256070 4:83102247-83102269 GTGAGCCACCACACCTGGCCAGG - Intronic
977678809 4:99776124-99776146 GTGAGCCACCACACCCATCCTGG - Intergenic
977838481 4:101672684-101672706 GTGAGCCACCTCACCTGGCCAGG - Intronic
980039565 4:127923860-127923882 GTGAGCCACCGCACCTGGCCTGG + Intronic
980057527 4:128093312-128093334 GTGAGCCACCGCACCTGGCCAGG - Intronic
980080360 4:128337668-128337690 GTGAGCCACCACACCTGGCCTGG + Intergenic
980897812 4:138876495-138876517 GCGAGCCTTCTCACCTCTCCGGG + Intergenic
980993275 4:139757365-139757387 GTGAGCCACCACACCTGGCCAGG - Intronic
981193645 4:141892833-141892855 GTGAGCCACCACACCTGGCCAGG + Intergenic
981557658 4:146012829-146012851 GTGAGCCACCGCTCCTCGCCAGG + Intergenic
981611222 4:146595816-146595838 GTGAGCCACTGCACCCCTCCTGG + Intergenic
981718706 4:147777535-147777557 GTGAGCCACCACACCTGGCCGGG + Intronic
981738912 4:147982681-147982703 GTGAGCCACCACACCTAGCCTGG + Intronic
982003762 4:151045553-151045575 TTGAGCCACCTCACCTGGCCTGG - Intergenic
982140231 4:152310489-152310511 CTGTGTCAGCTCAGCTCTCCAGG - Intergenic
982432216 4:155336082-155336104 GTGAGCCACCACACCTGGCCAGG + Intergenic
983193812 4:164782935-164782957 GTGAGCCACCACACCTGGCCTGG - Intergenic
983882527 4:172949625-172949647 GTGAGCCAGCGCACCCCGCTAGG - Intronic
983942870 4:173554415-173554437 GTGAGCCACCTCACCCTGCCAGG - Intergenic
984270521 4:177543450-177543472 GTGAGCCACCACACCTGGCCTGG - Intergenic
984753097 4:183297690-183297712 GTGAGCCACCGCACCTGGCCTGG + Intronic
984847485 4:184120238-184120260 GGAAGCCAGCTCCCCTGTCCTGG - Intronic
984947874 4:184983860-184983882 GTGAGCGGGCACACATCTCCCGG - Intergenic
985489173 5:169227-169249 GTGACCCTGCTCATCCCTCCGGG + Intronic
986016662 5:3763631-3763653 GTGAGCCACCACACCCGTCCTGG - Intergenic
986371838 5:7087923-7087945 GTGAGGCAGCTGCCCTCTGCTGG - Intergenic
986640083 5:9863545-9863567 GTGAGCCACCGCACCTAGCCAGG + Intergenic
986679813 5:10222403-10222425 CTGACCCAGCTCGCCTGTCCTGG - Intergenic
986732174 5:10643183-10643205 GTGAGCCACCGCACCTGGCCAGG + Intronic
986884441 5:12216305-12216327 GTGAGCCACCGCACCTGGCCTGG - Intergenic
987107946 5:14659367-14659389 GTGAGCCACCGCACCCCACCTGG + Intergenic
988464796 5:31478452-31478474 GTGAGCCATCACACCTGGCCAGG - Intronic
988497744 5:31759073-31759095 GTGGGGGAGCTCACCACTCCTGG - Intronic
988508092 5:31841688-31841710 GTGAGCCACCGCACCTAGCCAGG - Intronic
988730960 5:33972022-33972044 GTGAGCCACCACACCTGGCCAGG + Intronic
988824495 5:34921621-34921643 GTGAGCCACCTCACCTGGCCAGG - Intronic
989028617 5:37093540-37093562 GTGTGCAAGATCATCTCTCCTGG + Intergenic
989160727 5:38388335-38388357 GTGAGCCACCACACCTGGCCTGG - Intronic
989246932 5:39265197-39265219 GTGAGCCACCACACCTGGCCAGG - Intronic
989388884 5:40880239-40880261 GTGAGCCACCGCACCTGGCCCGG + Intergenic
989514750 5:42328795-42328817 GTGAGCCAACTCACCCGGCCAGG + Intergenic
989603240 5:43219521-43219543 GTGAGCCACCATACCTGTCCTGG + Intronic
990210121 5:53473840-53473862 ATGAGTCAGCACACCACTCCTGG + Intergenic
990921892 5:60977553-60977575 GTGAGCCACCACACCTGGCCTGG - Intronic
990971057 5:61506299-61506321 GTGAGCCACCACACCTGGCCTGG - Intronic
992122497 5:73609047-73609069 GTGAGCCATCACACCTGCCCAGG + Intergenic
992701102 5:79342776-79342798 GTGAGCCACCGCACCTGGCCAGG + Intergenic
992893033 5:81221566-81221588 GTGAGCCACCGCACCTGGCCTGG - Intronic
993196020 5:84746804-84746826 GTGAGCCACCACACCTAGCCAGG + Intergenic
993236164 5:85312798-85312820 GTGAGCCACCGCACCTGGCCAGG + Intergenic
993891109 5:93474840-93474862 GTGAGCCACCGCACCTGGCCGGG - Intergenic
994412792 5:99430455-99430477 GTGAGCAGGCCCAGCTCTCCAGG - Intergenic
994481049 5:100335268-100335290 GTGAGCAGGCCCAGCTCTCCAGG + Intergenic
995187486 5:109287413-109287435 GTGAGCCACCACACCTGGCCGGG - Intergenic
995318544 5:110804146-110804168 GTGAGTCACCTTACCTTTCCTGG - Intergenic
995597641 5:113764860-113764882 GTGAGCCACCCTACCTCACCAGG - Intergenic
996546151 5:124681168-124681190 GTGAGCCACCGCACCTGGCCTGG - Intronic
996817028 5:127585673-127585695 GTGAGCGAGCTGACCCCTCTGGG - Intergenic
997322553 5:132990633-132990655 CTGAGCCACCTCACCTTCCCTGG - Intergenic
997331342 5:133064221-133064243 GTGAGCCACCGCACCTGGCCAGG - Intronic
997451141 5:133984341-133984363 GTGAGCCACCTCGCCTGGCCAGG + Intronic
997469577 5:134109485-134109507 GTGAGCCACCGCACCTGGCCAGG - Intergenic
997588995 5:135061603-135061625 GTGAGCCACCACACCTGGCCGGG + Intronic
998134722 5:139668578-139668600 GGGAGCCAGCTCTGCTCGCCTGG + Intronic
998350685 5:141498647-141498669 GTGAGCCACCACACCTGGCCAGG - Intronic
998365218 5:141626082-141626104 GTCAGCCTGCTCCCCTCTGCTGG - Intronic
998492984 5:142563264-142563286 GTGAGCCACCGCACCTGGCCTGG - Intergenic
998537042 5:142943061-142943083 GTGAGCCACTGCACCTGTCCTGG + Intronic
1000293839 5:159895832-159895854 ATGAGCCACCTCACCTGGCCCGG - Intergenic
1001134884 5:169094344-169094366 GTGAGCCAACACACCTGGCCTGG - Intronic
1001465375 5:171960091-171960113 GTGAGCCACCTCACCTGGCTAGG - Intronic
1001468049 5:171986442-171986464 GTGAGCCACCACACCTGGCCTGG - Intronic
1001566469 5:172702636-172702658 GTGAGCCACCGCACCTGGCCGGG + Intergenic
1001614469 5:173031534-173031556 GTGAGCCACCTCGCCTGGCCAGG - Intronic
1002012928 5:176298366-176298388 GTGAGCCACCACACCTGTCCTGG + Intronic
1002131328 5:177083660-177083682 GTGAGCCACCTCACCTGGCCTGG - Intergenic
1002185091 5:177450665-177450687 CTGAGCCACCTCACCCCTCAGGG - Intronic
1002214911 5:177624370-177624392 GTGAGCCACCACACCTGTCCTGG - Intergenic
1002336127 5:178479466-178479488 GTGAGGCTGCTCTCCCCTCCAGG + Intronic
1002742338 5:181442948-181442970 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1003205488 6:4005826-4005848 GTGAGCCAGCGCACCCGGCCAGG + Intergenic
1003302554 6:4897632-4897654 GTGAGCCACCACACCTGGCCTGG - Intronic
1003545475 6:7054427-7054449 GTGAGCCACCACACCTGGCCTGG + Intergenic
1003652907 6:7977633-7977655 GTGAGCCACCTCTCCTGGCCAGG + Intronic
1003771437 6:9306665-9306687 GTGAGCCACCACACCTGGCCAGG - Intergenic
1003887284 6:10533022-10533044 GTGAGCCACCACACCTGGCCTGG - Intronic
1004214336 6:13687338-13687360 GTGAGCCATCACACCTGGCCAGG - Intronic
1004301606 6:14463460-14463482 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1004566585 6:16803712-16803734 GAGAGCCCGCTCTCCTCTGCAGG + Intergenic
1004616523 6:17295578-17295600 GTGAGCCACCGCACCCATCCTGG + Intergenic
1004684518 6:17929822-17929844 GTGAGCCACCACACCTGGCCTGG + Intronic
1004724740 6:18300370-18300392 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1004961094 6:20790076-20790098 GTGAGCCACCACACCTAGCCGGG + Intronic
1005465590 6:26109376-26109398 GTGAGCAAGCTCTTATCTCCAGG - Intergenic
1005586991 6:27286715-27286737 GTGAGCCACCGCACCCCACCCGG - Intronic
1005649879 6:27876731-27876753 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1005878797 6:30038019-30038041 GTGAGCCACCACACCTGACCAGG - Intergenic
1006611547 6:35297216-35297238 ATGGGCCAGGGCACCTCTCCAGG - Intergenic
1006666943 6:35701821-35701843 GTGAGCCACCACACCTGGCCAGG + Intronic
1006907134 6:37540124-37540146 GTGAGTCACCTAACCTCTCTGGG + Intergenic
1007035438 6:38668709-38668731 GTGAGCCACCACACCTGTCCTGG - Intergenic
1007221516 6:40282606-40282628 GCCAGCAAGCTCACCTCTCCGGG - Intergenic
1007511074 6:42374723-42374745 GTGAGCCACCACACCTGGCCAGG - Intronic
1007698993 6:43754719-43754741 GTGAGCCACCACACCTGGCCAGG - Intergenic
1009936076 6:70235830-70235852 GTGAGCCACCGCACCTGGCCTGG - Intronic
1010392714 6:75355683-75355705 ATGAGCCACCGCACCTGTCCTGG + Intronic
1010673746 6:78717708-78717730 GTGAGCCACCTCACCTGGCCTGG - Intergenic
1011522413 6:88223184-88223206 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1011567245 6:88689315-88689337 GTGAGCCACCACACCTGGCCTGG - Intronic
1011616505 6:89202573-89202595 GTGAGCCACCACACCTGGCCAGG + Intronic
1011688653 6:89845196-89845218 GTGAGCCACCGCACCTGGCCTGG + Intronic
1011961275 6:93093306-93093328 GTGAGCCACCACACCTGGCCAGG + Intergenic
1012760977 6:103300268-103300290 GTGAGCCACCACACCTCGCCTGG + Intergenic
1012994991 6:105964143-105964165 GTGAGCCACCTCACCTGGCCAGG + Intergenic
1013318468 6:108963782-108963804 AGGAGCCAACTCCCCTCTCCAGG + Intronic
1013365916 6:109437850-109437872 GTGAGCCACCGCACCTGGCCCGG + Intronic
1013802053 6:113957768-113957790 GTGAGCCACCACACCTGGCCAGG + Intronic
1013833911 6:114309428-114309450 GTGAGCCACCACACCTGGCCAGG - Intronic
1014328291 6:120027641-120027663 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1014512181 6:122337190-122337212 GTGAGCCAACGCACCTCACCAGG - Intergenic
1015453594 6:133399064-133399086 CAGCGCCAGCTCACCTCTGCTGG + Intronic
1015637209 6:135289211-135289233 GTGAGCCACCGCACCTGGCCAGG - Intronic
1015894979 6:138008359-138008381 GTGAGCCACCACACCGCGCCCGG + Intergenic
1016028694 6:139315106-139315128 TTGAGCCAGATCACCAGTCCAGG - Intergenic
1016285076 6:142463425-142463447 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1016470078 6:144366018-144366040 GTGAGCCACCGCACCTGGCCTGG + Intronic
1016823865 6:148370539-148370561 GTGAGCCACCGCACCTGGCCAGG - Intronic
1017147280 6:151246134-151246156 GTGAGCCACCGCACCTTGCCGGG - Intronic
1017155748 6:151321267-151321289 GTGAGCCACCACACCTGGCCAGG + Intronic
1017583877 6:155898630-155898652 GTGAGCCACCTCGCCTGGCCAGG + Intergenic
1017820452 6:158045390-158045412 GTGAGCCACCGCACCTAGCCAGG + Intronic
1017898913 6:158704107-158704129 GTGAGCCACCACACCTGGCCGGG + Intronic
1017925558 6:158909098-158909120 GTGAGCCACCACACCTGGCCTGG - Intronic
1018355524 6:163011059-163011081 GTGAATTAGCTCACCTCCCCTGG + Intronic
1019029143 6:168995340-168995362 GTGTCCCATCTCACCTCTCCTGG + Intergenic
1019247474 6:170718687-170718709 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1019787014 7:2983524-2983546 GTGAGCCACCGCACCTGGCCAGG + Intronic
1020093159 7:5352668-5352690 GTGAGCCGGCCCACCACTGCTGG + Intronic
1020170919 7:5844416-5844438 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1020184991 7:5952176-5952198 GTGAGCCAGCACACCTGGCCAGG - Intronic
1020238919 7:6377310-6377332 GTGAGCCACCTGACCTGGCCAGG - Intronic
1020297925 7:6772568-6772590 GTGAGCCAGCACACCTGGCCAGG + Intronic
1020836184 7:13154594-13154616 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1021686102 7:23187886-23187908 GTGAGCCACCACACCTGGCCTGG + Intronic
1021843891 7:24745551-24745573 GTCAGCCTTCTCACATCTCCAGG + Intronic
1021969719 7:25953436-25953458 GTGAGTCAGTTCACCACTCTGGG + Intergenic
1021970125 7:25957573-25957595 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1022060415 7:26787607-26787629 GTGAGCCACCACACCTGGCCAGG + Intronic
1022063284 7:26823141-26823163 GTGAGCCACCACACCTGGCCAGG - Intronic
1022244123 7:28541383-28541405 GTGAGCCACCGCACCTGGCCAGG - Intronic
1022553310 7:31263101-31263123 GTGAGCCACCGCACCTGGCCGGG + Intergenic
1022707708 7:32820153-32820175 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1023281164 7:38572185-38572207 GTGAGCCACCACACCTGGCCAGG + Intronic
1023412369 7:39900771-39900793 GTGAGCCACCACACCTGGCCTGG + Intergenic
1023634882 7:42199771-42199793 GTGAGCCACCACACCTGGCCAGG - Intronic
1023943608 7:44786085-44786107 GTGAGCCACCACACCTGGCCTGG + Intergenic
1024238924 7:47419001-47419023 GTGGCCCAGCTCACCTTTCCTGG - Intronic
1024251723 7:47510589-47510611 GTGAGCCACCGCACCTGGCCTGG - Intronic
1024277138 7:47687057-47687079 GTGAGCCACCACACCTGGCCTGG + Intergenic
1024676114 7:51639102-51639124 TAGGGCCAGCTCTCCTCTCCAGG + Intergenic
1025835821 7:65092646-65092668 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1025898455 7:65724930-65724952 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1025905601 7:65782099-65782121 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1025976187 7:66372016-66372038 GTGAGCCACCACACCTGGCCTGG - Intronic
1026189782 7:68114760-68114782 GTGAGCCACCACACCACACCAGG - Intergenic
1026374997 7:69741420-69741442 GTGAGCCACCGCACCTGTCCTGG - Intronic
1026528972 7:71180970-71180992 GTGAGCCACCGCACCTGGCCTGG - Intronic
1026897221 7:74016768-74016790 GTGAGCCACCTCACCCAGCCAGG + Intergenic
1026919242 7:74142917-74142939 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1026921012 7:74155425-74155447 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1027556108 7:79666694-79666716 GTGAGCCATCACACCTAGCCAGG + Intergenic
1027707299 7:81550176-81550198 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1028020598 7:85766192-85766214 GTGAGGCAGCACTCCTTTCCTGG - Intergenic
1029030106 7:97458207-97458229 GTGAGCCACCTCGCCTGGCCAGG + Intergenic
1029083626 7:97994342-97994364 GTGAGCCATCGCACCTGGCCGGG - Intergenic
1029139626 7:98400818-98400840 GTGAGCCGGTTCACCTCCTCGGG + Exonic
1029198447 7:98822855-98822877 CTGAGCCAGCACTGCTCTCCAGG + Intergenic
1029208795 7:98887947-98887969 GGGAGCCACCGCACCTGTCCTGG - Intronic
1029663907 7:101981890-101981912 GTGAGCCACCGCACCTGGCCAGG + Intronic
1029745530 7:102513906-102513928 GTGAGCCACCACACCTGGCCAGG - Intronic
1029763469 7:102612885-102612907 GTGAGCCACCACACCTGGCCAGG - Intronic
1029891681 7:103936373-103936395 GTGAGCCACTGCACCTCGCCTGG + Intronic
1030044882 7:105485993-105486015 GTGAGCCACTGCACCTATCCAGG + Intronic
1030091742 7:105864171-105864193 GTGAGCCACCACACCTGACCAGG - Intronic
1030175483 7:106649328-106649350 GTGAGCCACCACACCTGGCCTGG - Intergenic
1030222595 7:107111882-107111904 ATGAGCCACCTCACCTGGCCAGG - Intronic
1030583045 7:111383994-111384016 GTGAGCCACCTCACCTGGCTGGG - Intronic
1031047998 7:116914993-116915015 GTGAGCCACCGCACCCATCCAGG - Intronic
1031284482 7:119847456-119847478 GTGAGCCACCACACCTGACCAGG - Intergenic
1031370550 7:120959925-120959947 GTGAGCCACCACACCTGGCCTGG + Intronic
1031384041 7:121124357-121124379 GAGAGCCAGTTCACCTCAACAGG + Exonic
1032034641 7:128512809-128512831 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1032160827 7:129509030-129509052 GTGAGCCACCACACCTGGCCTGG - Intronic
1032218344 7:129974795-129974817 GTGAGCCACCTCACCTGGTCTGG + Intergenic
1032791589 7:135246694-135246716 GTGGGCCTGCTCACCTCCTCGGG - Exonic
1033119691 7:138656758-138656780 GTGAGCCACCACACCTGGCCAGG - Intronic
1033357774 7:140614385-140614407 GTGAGCCACCGCACCTGGCCAGG + Intronic
1033370947 7:140706971-140706993 GTGAGCCACCTCACCCGGCCTGG + Intronic
1033377721 7:140779648-140779670 GTGAGGCAGCACACCTGGCCAGG - Intronic
1033521913 7:142169146-142169168 GTGAGCCACCACACCTTGCCAGG - Intronic
1033918531 7:146358314-146358336 GTGAGCCACCTCGCCTGGCCTGG + Intronic
1033949168 7:146762316-146762338 GTGAGCCACCACACCTGGCCAGG - Intronic
1034121016 7:148627867-148627889 GTGAGCCACCACACCTGCCCAGG + Intergenic
1034560037 7:151874600-151874622 GTGAGCCATCACACCCATCCCGG - Intronic
1034737899 7:153446126-153446148 GTGAGCCACCACACCTGACCTGG - Intergenic
1034787690 7:153940525-153940547 GTAAATCAGCTCACCTCTCTGGG - Intronic
1034978571 7:155461632-155461654 TAGAGCCAGGTCCCCTCTCCTGG + Intronic
1035500664 8:89249-89271 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1035660247 8:1342227-1342249 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1036291303 8:7493824-7493846 GTGAACCACCACACCTGTCCTGG + Intergenic
1036903719 8:12690609-12690631 GTGAACCAGCTGTCCTCACCTGG + Intergenic
1037552580 8:19989267-19989289 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1037598062 8:20370986-20371008 GTGAGCCACCGCGCCTCACCTGG + Intergenic
1037782019 8:21876057-21876079 GTGAGCCACCTCACCTGACCTGG + Intergenic
1037837458 8:22222546-22222568 GTGAGCCACTTCACCTGGCCAGG + Intronic
1037937613 8:22925787-22925809 CTGGCCCAGCTGACCTCTCCTGG + Intronic
1038146328 8:24899870-24899892 GTGAGCCATCGCTCCTGTCCGGG - Intergenic
1038255176 8:25944365-25944387 GTGAGCCAGCTCATCCCTTGGGG + Intronic
1038417299 8:27406546-27406568 GTGAGTCAGCTCTTCTCCCCAGG + Intronic
1038537522 8:28364366-28364388 GTGAGCCACTGCACCTGTCCAGG - Intronic
1038600619 8:28938729-28938751 ATGAGCCACCTCACCTGGCCAGG + Intronic
1038678911 8:29648668-29648690 GTGAGCCACCACACCTGGCCTGG + Intergenic
1038686312 8:29721793-29721815 GCGGGTCACCTCACCTCTCCAGG - Intergenic
1038764462 8:30414481-30414503 GTCAGCCAGCTCTGCTCTGCTGG + Intronic
1039436460 8:37562813-37562835 GTGACCCAGCTCAAGTCTCATGG + Intergenic
1039553227 8:38458256-38458278 GTGAGCCACCGCACCTGGCCTGG - Intronic
1039722506 8:40179813-40179835 TTCAGCCAGATCACCCCTCCTGG + Intergenic
1039736399 8:40337329-40337351 GAGAGTCAGGTCACCTCTTCAGG + Intergenic
1039877766 8:41602238-41602260 GTGAGCCACCACACCTGGCCTGG + Intronic
1039956866 8:42214512-42214534 GTGAGCCACCTCACCTGGCCTGG - Intergenic
1040959543 8:53017761-53017783 GTGAGCCACCACACCTGGCCCGG - Intergenic
1041184932 8:55289231-55289253 GTGAGCCACCTCAACTGGCCTGG - Intronic
1041402699 8:57461981-57462003 GTGTGCAAGATCATCTCTCCTGG + Intergenic
1041497490 8:58503061-58503083 GTGAGCCACCACACCTGGCCAGG + Intergenic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1042043295 8:64619041-64619063 GAAAGCCAGCTAACATCTCCAGG - Intronic
1042077033 8:65007534-65007556 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1042153192 8:65811922-65811944 GTGAGCCACCTCGCCTGGCCTGG - Intronic
1043442383 8:80287584-80287606 GTGAGCCATCGCACCTGTCCTGG + Intergenic
1043454464 8:80399778-80399800 GTGAGCCAGAGCACCTGGCCAGG + Intergenic
1043956137 8:86361611-86361633 GTTAGTCATCTCACCTCTCTGGG + Intronic
1044590987 8:93914578-93914600 GTGAGCCACCGCACCTGGCCTGG + Intronic
1047155050 8:122307622-122307644 GTGAGCCACCACACCTGGCCAGG - Intergenic
1048017126 8:130507382-130507404 GTGAGCCAGCGCGCCTGGCCAGG - Intergenic
1048894751 8:138981250-138981272 GTGAGCCACCTCACCCAGCCGGG + Intergenic
1049153739 8:141054663-141054685 GTGAGCCATCGCACCTGGCCAGG - Intergenic
1049158107 8:141079375-141079397 GTGAGCCACCACACCTGGCCAGG + Intergenic
1049496343 8:142935909-142935931 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1050351548 9:4744926-4744948 GTGAGCCACCACACCTGGCCTGG - Intergenic
1050925107 9:11255081-11255103 GTATGCCAGATCATCTCTCCTGG - Intergenic
1051136418 9:13926879-13926901 GTGAGCCACCACACCTGTCCTGG + Intergenic
1051406342 9:16741673-16741695 GTGAGCCACCGCACCTGTCATGG - Intronic
1051454773 9:17242591-17242613 GTGAGCCACCACACCTGGCCAGG + Intronic
1051520541 9:17982330-17982352 GTGAGCCACCACACCTGGCCTGG - Intergenic
1053124402 9:35567972-35567994 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1053214620 9:36260131-36260153 GTGAGCCACCACACCTGGCCCGG - Intronic
1053360418 9:37482709-37482731 GTGAGCCACCACACCTGGCCAGG - Intergenic
1053375401 9:37601762-37601784 GTGAGCCACCACACCTGGCCAGG - Intronic
1053515877 9:38730224-38730246 GTGAGCCACCACACCCCACCTGG + Intergenic
1053881514 9:42600051-42600073 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1054961497 9:70975148-70975170 GTGAGCCACCGCACCCCGCCTGG + Intronic
1055632604 9:78238770-78238792 GTGAGCCACCGCACCTGGCCTGG - Intronic
1055708434 9:79033489-79033511 GTGGGGCAGCTCCCCTCTGCTGG + Intergenic
1055789503 9:79907946-79907968 GTGAGCCACCTTACCTGGCCTGG - Intergenic
1056416037 9:86377025-86377047 GTGAGCCACCACACCTGGCCCGG + Intergenic
1056540328 9:87565460-87565482 GTGAGGCACTTCACCTCTCCTGG - Intronic
1056757080 9:89388622-89388644 GTGCCCCAGCTCACCGCTCCAGG + Exonic
1056774172 9:89498941-89498963 GCGAGCCCTGTCACCTCTCCTGG - Intergenic
1056783878 9:89573993-89574015 GTGAGCCACCTCACCCAGCCAGG + Intergenic
1057280707 9:93709095-93709117 CTGAGCCAGCTCCCCATTCCAGG - Intergenic
1057375727 9:94521015-94521037 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1057449997 9:95149759-95149781 GTGAGCCACCACACCTGGCCGGG + Intronic
1057756914 9:97846524-97846546 GAGGGCAAGCTCAGCTCTCCTGG + Intergenic
1057842751 9:98499767-98499789 GTGAGCCACCGCACCTGGCCTGG - Intronic
1057895111 9:98903099-98903121 CGGTGCCTGCTCACCTCTCCAGG + Intergenic
1058222188 9:102315804-102315826 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1058725590 9:107800639-107800661 GTGAGCCACCGCACCTGACCCGG - Intergenic
1058858661 9:109092393-109092415 GTAAGTCAGCTCACCTCACTAGG + Intronic
1058901159 9:109443491-109443513 GTGAGCCACCACACCTGGCCAGG + Intronic
1058971530 9:110087688-110087710 ATGAACCAGCTCACCTAGCCGGG - Intronic
1059207823 9:112483241-112483263 GTGAGCCACCACACCTGGCCAGG - Intronic
1059332373 9:113543651-113543673 GGCAGCAAGCTCATCTCTCCTGG + Intronic
1059352159 9:113673104-113673126 GTGAGCCACCTCACCCAGCCAGG + Intergenic
1059483556 9:114610937-114610959 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1060281165 9:122216628-122216650 GGGAGCCAAGTCATCTCTCCAGG + Intronic
1060427626 9:123519698-123519720 GTGAGCCACCACACCTGGCCTGG + Intronic
1060941881 9:127547246-127547268 GTGAGCCACCGCACCTGGCCAGG - Intronic
1061070709 9:128308668-128308690 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1061091032 9:128426340-128426362 GTGAGCCACCGCACCTGGCCAGG - Intronic
1061092173 9:128432863-128432885 GTGAGCCACCGCACCTGGCCTGG - Intronic
1061110651 9:128567569-128567591 GTGAGCCACCACACCTGGCCTGG + Intronic
1061397707 9:130352627-130352649 GTGAGCCACTTCCCCTCTCTGGG - Intronic
1061536855 9:131255663-131255685 GTGAGCCACCGCACCCCGCCAGG + Intergenic
1061626438 9:131843252-131843274 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1061628922 9:131859301-131859323 GTGAGCCACCGCACCCCGCCTGG + Intergenic
1061772534 9:132937159-132937181 GTGAGCCACCACACCTGGCCTGG - Intronic
1061806176 9:133138914-133138936 ATGAGCCACCGCACCTGTCCAGG + Intronic
1061998475 9:134202850-134202872 GTGAGCCACCACACCTGGCCTGG - Intergenic
1062283031 9:135760345-135760367 CTGAGGCAGCTGCCCTCTCCAGG - Intronic
1062335631 9:136065201-136065223 GTGAGCCACCTCACCTGGTCTGG - Intronic
1062476554 9:136730539-136730561 GTGAGCCACCGCACCTAGCCTGG - Intergenic
1062608399 9:137359388-137359410 GTGAGCCACCGCACCTGGCCTGG - Intronic
1062687653 9:137823378-137823400 GTGAGCCACCGCACCGCACCCGG + Intronic
1203732359 Un_GL000216v2:102091-102113 GTGAGCCAGCACACCCAGCCTGG + Intergenic
1203608247 Un_KI270748v1:74167-74189 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1185471186 X:384700-384722 GTGAGCCACCACACCTGGCCTGG - Intronic
1185560432 X:1056531-1056553 GTGAGCCACCGCACCTGGCCCGG + Intergenic
1185701710 X:2235829-2235851 GTGAGCCACCGCACCCGTCCTGG - Intronic
1185709517 X:2292020-2292042 GTGAGCCACCACGCCTGTCCAGG + Intronic
1185715170 X:2335732-2335754 GTGAGCCACCGCACCTGGCCAGG + Intronic
1185933081 X:4224666-4224688 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1186893152 X:13979979-13980001 GTGAGCCACCACACCTGACCTGG + Intergenic
1187416309 X:19096126-19096148 GTGAGCCACCGCACCTGGCCTGG - Intronic
1187582786 X:20626724-20626746 GTGAGCCACCACACCTGGCCAGG + Intergenic
1187745416 X:22403878-22403900 ATGAGCCAGCGCACCTGGCCTGG - Intergenic
1187798648 X:23034460-23034482 GTGAGCCAGTGCACCTGGCCAGG - Intergenic
1188325985 X:28801161-28801183 GTGAGCCACCACACCTGGCCAGG + Intronic
1188341825 X:29012258-29012280 GTGAGCCACCTCACCCCGCCAGG - Intronic
1188518032 X:31008671-31008693 ATGAGCCACCTCACCTGGCCAGG - Intergenic
1189105364 X:38230092-38230114 GTGAGCCACCGCACCTGGCCTGG - Intronic
1189314602 X:40045795-40045817 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1189368353 X:40407489-40407511 GTGAGCCACCACACCTGACCAGG + Intergenic
1189369455 X:40416211-40416233 GTGAGCCACCACACCTGGCCAGG - Intergenic
1189396796 X:40629899-40629921 GTGAGCCATCACACCTGGCCTGG + Exonic
1189436169 X:40994564-40994586 GTGAGCCACCACACCTGGCCTGG + Intergenic
1189568171 X:42265422-42265444 GTGAGCCACCACACCTAGCCAGG + Intergenic
1189797983 X:44664129-44664151 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1189804078 X:44718094-44718116 GTGAGCCACCACACCTGGCCTGG + Intergenic
1189849460 X:45164438-45164460 GTGAGCCACCACACCTGGCCAGG - Intronic
1189870786 X:45381082-45381104 ATGAGCTTGCTCAGCTCTCCTGG + Intergenic
1190071517 X:47283740-47283762 GTGAGCCACCGCACCTGACCTGG - Intergenic
1190104867 X:47552542-47552564 GTGAGCCACCACACCTGGCCAGG - Intergenic
1190213166 X:48463318-48463340 GTGAGCCACCACACCTGGCCTGG - Intronic
1190295330 X:49023521-49023543 GTGAGCCACCGCACCTGACCAGG + Intergenic
1190632276 X:52399569-52399591 GTGAGCCACCACACCTATTCTGG + Intergenic
1190652186 X:52578040-52578062 GGGAGCCTGATCACCTCTCAGGG - Intergenic
1190723206 X:53168400-53168422 GTGAGCCACCACACCTGGCCTGG - Intergenic
1190871698 X:54430216-54430238 GTGAGCCACCGCACCTGGCCAGG + Intergenic
1191869016 X:65729704-65729726 GGGAACCACCTCACCTCTGCGGG - Exonic
1192449534 X:71235265-71235287 GTGAGCCACCACGCCTCGCCAGG + Intergenic
1192751439 X:73996606-73996628 GTGAGCCACCACACCTGGCCAGG + Intergenic
1193235666 X:79103992-79104014 GTGAGCCACCGCACCTGGCCTGG + Intergenic
1194276903 X:91896404-91896426 GTGAGCCACCGCACCGCACCTGG + Intronic
1194303279 X:92212630-92212652 GTGAGCCACCGCACCTGGCCTGG + Intronic
1194487073 X:94497745-94497767 ATGTGCAAGATCACCTCTCCGGG + Intergenic
1194620272 X:96162437-96162459 GTGAGCCAGATTACCTGTCTGGG + Intergenic
1194646590 X:96465395-96465417 GTGAGCCACCGCACCTGGCCGGG - Intergenic
1195161462 X:102175869-102175891 GTGTGCAAGATCATCTCTCCCGG - Intergenic
1195307671 X:103601645-103601667 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1195680083 X:107538939-107538961 GTGAGCCACCACACCTGGCCTGG + Intronic
1195822442 X:108960986-108961008 GTTATCCAGTTCTCCTCTCCTGG + Intergenic
1195839792 X:109161973-109161995 GTGAGCCAACACACCTGACCTGG - Intergenic
1195970109 X:110463668-110463690 GTGAGCCACCACACCTGGCCTGG - Intergenic
1196151541 X:112380432-112380454 GTGAGCCACCGCACCTGGCCCGG + Intergenic
1196158074 X:112452747-112452769 GTGAGCCACCGCACCTGGCCAGG - Intergenic
1196437847 X:115691262-115691284 GTCATCAAGCTCACCTCTCTGGG - Intergenic
1196589800 X:117472882-117472904 GTGAGCCACCACACCTGGCCTGG + Intergenic
1196811650 X:119633763-119633785 GTAAGACACCTCACCTCTCTGGG - Intronic
1196923564 X:120609463-120609485 GTGAGCCACCACACCTGGCCAGG + Intronic
1197111583 X:122781359-122781381 ATGAGCCACCACACCTGTCCTGG - Intergenic
1197164482 X:123361453-123361475 GGGAGCCCAGTCACCTCTCCTGG + Intronic
1197221428 X:123917565-123917587 GTGAGCCACCTCGCCTGGCCTGG + Intergenic
1197265043 X:124360317-124360339 GTGAGCCACCACACCTAGCCAGG - Intronic
1197390410 X:125856330-125856352 ATGAGCCACCACACCTCACCTGG + Intergenic
1197467391 X:126821246-126821268 ATGAGCCAGCTTTCCTCTGCAGG - Exonic
1197762364 X:130036861-130036883 GTGAGCCACCGCACCTGGCCTGG - Intronic
1197798398 X:130322511-130322533 GTGAGCCACCGCACCTGGCCTGG - Intergenic
1198004280 X:132476167-132476189 ATGAGCCAGAGCTCCTCTCCTGG + Intronic
1198125664 X:133641191-133641213 GTGAGCCACCACACCTGGCCTGG - Intronic
1198631561 X:138644560-138644582 GTGAGCCACCGCACCTGGCCAGG + Intronic
1198828086 X:140719805-140719827 GTGAGCCACCACACCTGGCCTGG - Intergenic
1199327473 X:146515854-146515876 GTGAGCCACCGCACCCCGCCAGG + Intergenic
1199765706 X:150940365-150940387 GTGAGCCACGGCACCTGTCCGGG - Intergenic
1200080923 X:153575959-153575981 GGGAGCCACCTCGCCTCACCCGG + Intronic
1200167412 X:154046387-154046409 GTGAGCCAGCCCAGCTCTGTGGG + Intronic
1200230060 X:154439393-154439415 GTGAGCCACCGCACCTGGCCAGG - Intronic
1201635963 Y:16123528-16123550 GTGAGCCACCACACCTGGCCTGG + Intergenic