ID: 1148834374

View in Genome Browser
Species Human (GRCh38)
Location 17:50458106-50458128
Sequence AAGGTTCCTTCTGATGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148834367_1148834374 26 Left 1148834367 17:50458057-50458079 CCACATCTTGAAAAACTGTCACT 0: 1
1: 0
2: 3
3: 37
4: 358
Right 1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG 0: 1
1: 0
2: 0
3: 15
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148834374 Original CRISPR AAGGTTCCTTCTGATGTCCC TGG Intronic
901396817 1:8987821-8987843 ACGATTCTTTCTGCTGTCCCTGG - Intergenic
902825464 1:18970561-18970583 ATGATGCCTTCTGATGTTCCGGG - Intergenic
903064695 1:20692733-20692755 AATGTTCATTCTGATCTTCCTGG + Intronic
903178073 1:21592165-21592187 ACCCTTCCTTCTGATGTCTCTGG + Intergenic
904740189 1:32668773-32668795 AGCCTTCCTTCTGATGTCCACGG - Exonic
905349231 1:37333136-37333158 CAGCTTCCTTCTGATGTCTAAGG + Intergenic
905494170 1:38371532-38371554 AAAGTTCCTCCTGAAGTCCCTGG + Intergenic
906693472 1:47808767-47808789 TGGGTTCTTTCTGCTGTCCCTGG + Intronic
907296474 1:53459293-53459315 AAGGTTCCTGCTGCAGTTCCCGG + Intergenic
907409276 1:54273429-54273451 AAGGTTACTCCTGACGTGCCAGG - Intronic
907684616 1:56598239-56598261 AAGGACCCTTCTGATATCCGTGG + Intronic
908522216 1:64955370-64955392 AAGGCCCCTTCAAATGTCCCTGG - Intronic
911856788 1:102887909-102887931 TTGGTTCCTTCTGAGGTCCATGG - Intronic
912093967 1:106116331-106116353 AAGGTAACTTCTGATGGCCTGGG + Intergenic
912230460 1:107787047-107787069 AATGGTCCTTCAGAGGTCCCTGG - Intronic
912363323 1:109112884-109112906 AACGTTCCCTCTGCAGTCCCCGG - Intronic
912756787 1:112330953-112330975 ATGTGTCCTCCTGATGTCCCAGG - Intergenic
914890277 1:151615565-151615587 AAGTTTACCTCTGTTGTCCCAGG + Intronic
916874278 1:168952465-168952487 AAAGTTTTTTCTGATGTCTCAGG - Intergenic
917520489 1:175744048-175744070 AGGGTTCCTTCTGCTGAGCCCGG - Intergenic
919256964 1:195138503-195138525 GAGCTTCCTCCTGATGTCCGTGG - Intergenic
919979347 1:202632697-202632719 GAGGCTCCTCCTGATTTCCCTGG + Intronic
1064532163 10:16321709-16321731 AAGGACCCTTCTGATGACACTGG - Intergenic
1066385698 10:34939558-34939580 AAGGTTTCTTCCTATGTCCCTGG - Intergenic
1070560969 10:77566277-77566299 AAGTTGGCTTCTGATCTCCCTGG + Intronic
1070589667 10:77792806-77792828 AAACTTCCTTCTGATGCCCTGGG - Intronic
1076889415 10:133276560-133276582 AAGGTTCCCTCCGACCTCCCCGG + Intronic
1079040680 11:17056665-17056687 AATGTTCCTCCTAATGTCACAGG - Intergenic
1080312948 11:30915262-30915284 AATGTTCCCTCTGATCTCCTGGG - Intronic
1082235316 11:49815924-49815946 AATGTTCATCCTGATGTCACAGG + Intergenic
1082284631 11:50305386-50305408 AAGGAACCTTCTTATGTCCTGGG - Intergenic
1082609002 11:55276894-55276916 AATGTTCATCCTGATGTCACAGG + Intergenic
1082892792 11:58158108-58158130 AAGCTTCATTCTCATGTCTCTGG + Intronic
1082937489 11:58669941-58669963 AATGTTACTTCTAATGTCACAGG - Intronic
1084162691 11:67358542-67358564 AAGGTGCCTGCTGATATCACCGG + Intronic
1086701545 11:89905357-89905379 AATGTTCATCCTGATGTCACAGG - Intergenic
1086704622 11:89939168-89939190 AATGTTCATCCTGATGTCACAGG + Intergenic
1092857013 12:12683882-12683904 CATCTTCCTTCTGATGTTCCTGG - Intronic
1093364669 12:18278405-18278427 AAGGATCCTTGTGATTACCCTGG + Intronic
1093783565 12:23166342-23166364 AAGGTTCCTTGCCATTTCCCTGG + Intergenic
1095357383 12:41291876-41291898 AAGGTTGCATCTCATGTACCAGG - Intronic
1096075472 12:48801155-48801177 AAGGCTCCTGCTGTTGTCCCCGG - Intergenic
1099179353 12:79459547-79459569 AATGTTACTCCTGATGTCACAGG + Intergenic
1099182013 12:79479922-79479944 AATGTTACTCCTGATGTCACAGG + Intergenic
1102630162 12:114271202-114271224 TAGGTTCTTTCTGAAGTCACTGG - Intergenic
1104644040 12:130484539-130484561 AAGGTGCCTGCTCATGTTCCAGG - Intronic
1107022933 13:35770171-35770193 AAGATTCCTTCTGACGTCCTAGG + Intronic
1107412275 13:40168933-40168955 AACATTCCTTCTCATGTCACTGG + Intergenic
1108714834 13:53068896-53068918 AAGCTTCTTTCTGTTTTCCCAGG + Intergenic
1111809390 13:93079803-93079825 AATGTTCCTGCTGATGGCCTAGG - Intergenic
1112677331 13:101717713-101717735 AAAATTCCTTCTGAGCTCCCAGG + Exonic
1114400900 14:22409480-22409502 CAGGTTCCTTAAGATGACCCAGG + Intergenic
1116514497 14:45788788-45788810 AAGCTTGCTTCTGATGTCAGGGG - Intergenic
1116948506 14:50857743-50857765 AAGGTTCCGGCAGATGTGCCTGG + Intergenic
1117274095 14:54174750-54174772 AAGTTTTCTTCTGATGTCTCAGG + Intergenic
1121288972 14:92759056-92759078 AAGGGTCCTTGTGATTTCACTGG - Intergenic
1123982527 15:25616769-25616791 AAGGATCCTTTTGAAGTCCTTGG + Intergenic
1126229649 15:46310059-46310081 AAGCTCACTTCTGATGTTCCTGG + Intergenic
1126353117 15:47765773-47765795 AATATTCCTTATGATTTCCCAGG + Intronic
1127707374 15:61560510-61560532 CAGGATCCTTCTGATGACCAGGG - Intergenic
1127871533 15:63078009-63078031 AAGGCTCCTTCAGACCTCCCTGG - Intergenic
1130660030 15:85824096-85824118 AAGGTTCCCACTGCAGTCCCTGG + Intergenic
1133449840 16:5894634-5894656 GAGTTTCCTTCTGAGCTCCCTGG + Intergenic
1134386389 16:13777415-13777437 AACTTACCTTCTCATGTCCCAGG + Intergenic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1135294212 16:21265119-21265141 CTGGTTCCTTTTGATTTCCCAGG + Intronic
1135299621 16:21314317-21314339 AAGGTTCCTTTTAATAACCCAGG - Intergenic
1136560227 16:31034544-31034566 AAGGATCTGTCTGAGGTCCCAGG - Intronic
1141216985 16:82033900-82033922 GAGGTTCCTTCTACTGTTCCAGG + Intergenic
1141875070 16:86818645-86818667 AAGGTTGCTTCTCATTTCCAGGG - Intergenic
1144663895 17:17089273-17089295 CAGCTTCCTTCTGAGGTCCCGGG + Intronic
1147292023 17:39451187-39451209 AAGGATCAATCTGAAGTCCCCGG + Exonic
1148776583 17:50099169-50099191 AAGGTACCATCTGTTCTCCCTGG + Intronic
1148834374 17:50458106-50458128 AAGGTTCCTTCTGATGTCCCTGG + Intronic
1152230805 17:79113133-79113155 AAGGGCCCTGCTGATGACCCAGG + Intronic
1155047462 18:22115292-22115314 AACGCTCTTTCTGATGTCCTTGG + Intergenic
1156218738 18:35029406-35029428 ACGCTTCCTTCCAATGTCCCTGG + Intronic
1157832665 18:50871240-50871262 AAGGCTCATTCTGATGTCCATGG + Intergenic
1159945794 18:74443925-74443947 TAGTTTCCTTCTCATCTCCCAGG + Intronic
1163454934 19:17400917-17400939 ATGGTTCCTACTGCTGTCCCAGG - Intergenic
1165393515 19:35551437-35551459 AAGGCTTCTTCAGGTGTCCCTGG - Exonic
925779568 2:7369939-7369961 AAGTTGCCTTCTGAAGTGCCTGG + Intergenic
925779577 2:7370000-7370022 AAGTTGCCTTCTGAAGTGCCTGG + Intergenic
925779586 2:7370061-7370083 AAGTTGCCTTCTGAAGTGCCTGG + Intergenic
926445365 2:12935315-12935337 AAAGTTCCTTCTTGTCTCCCAGG - Intergenic
928868704 2:35949623-35949645 GAGGCTCCTCCTCATGTCCCTGG - Intergenic
930753739 2:54955695-54955717 AGGGTCCCTTCTGACCTCCCAGG + Intronic
933967004 2:87438134-87438156 CAGGTTCCCTCTGAAGTCCTGGG - Intergenic
936326793 2:111512363-111512385 CAGGTTCCCTCTGAAGTCCTGGG + Intergenic
940423132 2:153501657-153501679 AAGATAACTTCTGATGTCCAGGG - Intergenic
942602604 2:177656982-177657004 AAGGTACCTTCCGAAGTCCTCGG - Intronic
946086630 2:217180051-217180073 CAGGTTCCTTCTGACATCCTGGG + Intergenic
1170168009 20:13381551-13381573 AAGGTTTATTCTGATGCCACAGG + Intergenic
1171141302 20:22745974-22745996 AAGGTTCCAGCTGATGTACATGG - Intergenic
1172902262 20:38343933-38343955 AAGGTCCCTGCTGATGGCCCAGG - Intergenic
1172971716 20:38878362-38878384 AAGCTTCCCTCTGATTTCCCTGG - Intronic
1174065978 20:47866469-47866491 AAGGCTACTCCTGATGTCACAGG - Intergenic
1180613902 22:17115097-17115119 AAAGTGCCTTCTGATATGCCTGG + Exonic
1183275200 22:36891850-36891872 AATGTTCTTGCTTATGTCCCAGG - Intergenic
1184283083 22:43450013-43450035 ATGGTACCTGCTGGTGTCCCTGG - Intronic
949886773 3:8701533-8701555 AACGTTCCTACTAATGTCACAGG - Intronic
951103222 3:18713465-18713487 GAGGTTCCCTCCAATGTCCCTGG + Intergenic
953436560 3:42881876-42881898 CAGGTTCCTTCTGTTTTTCCTGG + Intronic
956715717 3:72078181-72078203 AAGTTTACTTCTGAAGTCCATGG - Intergenic
961271392 3:125692275-125692297 AATGTTAATTCTGATGTCACAGG - Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962868996 3:139472036-139472058 ACAGTGCCTTCTGGTGTCCCAGG + Intronic
963527098 3:146428981-146429003 CAGGAACCTTCTCATGTCCCTGG + Intronic
964862213 3:161215398-161215420 AAGGTTGAGTCTGATGTCCAAGG - Intronic
975051140 4:69866478-69866500 GTGGTTCCTTCTAATGTCACTGG + Intergenic
976922169 4:90454337-90454359 CAGCTTCCTTCTGATGTCTGGGG + Intronic
978903597 4:113980827-113980849 AAAGTTCCTGCTGAGTTCCCAGG + Intergenic
979916480 4:126441038-126441060 AAGTTTTCTTCTGAGGTCCTAGG + Intergenic
980332721 4:131430085-131430107 AAGGATCCCACTCATGTCCCAGG - Intergenic
980854654 4:138424811-138424833 AAGGCTCTTTCTGATCTCCCTGG + Intergenic
984691172 4:182727608-182727630 TAGTTTCCTTCTGATGCTCCTGG + Intronic
985096957 4:186422212-186422234 ATGGTTCCTTCTGATGTGAAAGG + Intergenic
987124375 5:14797860-14797882 AGCCTTCCTTCTGATGTCCACGG + Intronic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
993854964 5:93062641-93062663 AAGGTCCATTCTGATTTTCCAGG - Intergenic
994186840 5:96824366-96824388 AAGGTCTCTTCTGCTGGCCCAGG + Intronic
997259114 5:132451902-132451924 AGGGTTCCTCCTGATGTCACTGG - Intronic
997686440 5:135791300-135791322 AATGTTACTTCTGATGTCACAGG + Intergenic
998123462 5:139598952-139598974 AAGTCTCGTTCTGTTGTCCCAGG + Intronic
998920204 5:147059786-147059808 ATGGTTGCTTCTGCTCTCCCAGG - Intronic
999831846 5:155327708-155327730 AAGATTCCTTCTGATACACCAGG + Intergenic
999847238 5:155497682-155497704 AAGGTCCCTTCTGATGTTAATGG + Intergenic
1000107169 5:158071074-158071096 CAGGTTCCTGGTGATGGCCCTGG + Intergenic
1001339071 5:170827009-170827031 CAGGGTCCTTTTGATGTACCCGG - Intergenic
1004248652 6:14003870-14003892 CAAGCTCCTTCTGATGCCCCAGG + Intergenic
1006828974 6:36957502-36957524 TTGGTTCCTGCTGTTGTCCCAGG + Intronic
1007144987 6:39620150-39620172 CATGTTCCTTCTGATGCTCCAGG + Intronic
1007345912 6:41229244-41229266 AAGGTACCCTCAGAGGTCCCTGG + Intronic
1008877935 6:56349894-56349916 TTGGTTCCTAATGATGTCCCAGG - Intronic
1008904747 6:56663929-56663951 AATTTTCCTTTTAATGTCCCTGG - Intronic
1009212085 6:60874103-60874125 AGCCTTCCTTCTGATGTCCACGG + Intergenic
1012576633 6:100809949-100809971 AGGTTTCCTTCTGGTGTACCAGG - Intronic
1018704641 6:166454710-166454732 GTGGCTCCTTCTGATGGCCCTGG - Intronic
1021190935 7:17619033-17619055 AAGTTTCCTTCTCATTTCCTTGG - Intergenic
1021730953 7:23595264-23595286 TAGTTACATTCTGATGTCCCTGG - Intergenic
1024899189 7:54298249-54298271 AAGGCTGGTTCTGATGTGCCAGG + Intergenic
1024957552 7:54940502-54940524 CAGGTTGCTTCTTATGTGCCAGG + Intergenic
1028011857 7:85655569-85655591 AAAGCTCCTTCTGCTATCCCAGG + Intergenic
1030214101 7:107025796-107025818 AAGATTCCTTCTAATGTTCTGGG + Intergenic
1032672507 7:134098285-134098307 AAGGACCTTTCTGATGTCACCGG - Intergenic
1033433846 7:141314380-141314402 AAGGTTCCTTCTGATGGGGCAGG + Intronic
1034584603 7:152078055-152078077 GAGGTTTCTTCTGATCTCTCGGG - Intronic
1037533766 8:19806038-19806060 AAGGTTCCTTCTGAAGGCTGTGG + Intergenic
1037564313 8:20104695-20104717 AATCTTCCTTCTGAGGTGCCAGG - Intergenic
1038980359 8:32752648-32752670 AAGGAGCCATCTGAAGTCCCTGG - Intronic
1042228775 8:66536508-66536530 CTGGGTCCTTCTGATGCCCCAGG - Intergenic
1042749822 8:72146641-72146663 GAGGTTTTTCCTGATGTCCCAGG - Intergenic
1043482791 8:80669754-80669776 AAGGTCCCTTCTCAGATCCCTGG + Intronic
1047802982 8:128329685-128329707 AAGGTACCTGTTGATGTGCCAGG + Intergenic
1048887402 8:138919378-138919400 AAGTCTCCTTCTGAAGTCTCTGG + Intergenic
1049032726 8:140049402-140049424 AAGGTTCCTGCTATTGTACCCGG + Intronic
1051714855 9:19971803-19971825 CAGGTTGCTTATTATGTCCCAGG + Intergenic
1055717168 9:79130755-79130777 TAGGTTCCTTGTGCTGTGCCAGG + Intergenic
1059485502 9:114623716-114623738 AAGGTTCCTTGTGATTTCATGGG + Intronic
1061729266 9:132600876-132600898 TAGGTCCTTTCTGATGTACCGGG - Intronic
1062472755 9:136713433-136713455 AGGGTTCCTCCTGCTGACCCAGG - Intronic
1185557762 X:1034837-1034859 AAGCTTGCTTCTGCAGTCCCCGG + Intergenic
1187648694 X:21375757-21375779 AAGGTTCCCCCTTTTGTCCCTGG + Intronic
1193968265 X:88017125-88017147 AAAGTTTCTTCTGATGTAACTGG + Intergenic
1195078654 X:101350754-101350776 AAGGTTCTTTTTGATGGCCATGG + Intronic
1195254981 X:103081790-103081812 AAGGTCCCCTCTCCTGTCCCAGG - Intronic
1196561701 X:117157117-117157139 AATGTTCCATTTGATGTACCAGG + Intergenic
1198258856 X:134948499-134948521 GAGGCTCTTTCAGATGTCCCTGG + Intergenic
1198861594 X:141076643-141076665 AAGGTTCCTTGTTATTTCCGAGG + Intergenic
1198901097 X:141510740-141510762 AAGGTTCCTTGTTATTTCCGAGG - Intergenic