ID: 1148834995

View in Genome Browser
Species Human (GRCh38)
Location 17:50461318-50461340
Sequence CTGCATGAGCACCCATGCAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148834995_1148834999 -3 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148834999 17:50461338-50461360 CAGTTGGCCACCGCCCAGGCGGG 0: 1
1: 0
2: 2
3: 19
4: 159
1148834995_1148835005 13 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835005 17:50461354-50461376 AGGCGGGCATCATTCTGGTGAGG 0: 1
1: 0
2: 0
3: 8
4: 104
1148834995_1148835008 18 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835008 17:50461359-50461381 GGCATCATTCTGGTGAGGAGGGG 0: 1
1: 0
2: 2
3: 13
4: 173
1148834995_1148835002 8 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835002 17:50461349-50461371 CGCCCAGGCGGGCATCATTCTGG 0: 1
1: 0
2: 0
3: 1
4: 57
1148834995_1148834998 -4 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148834998 17:50461337-50461359 GCAGTTGGCCACCGCCCAGGCGG 0: 1
1: 0
2: 1
3: 13
4: 129
1148834995_1148834997 -7 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148834997 17:50461334-50461356 CATGCAGTTGGCCACCGCCCAGG 0: 1
1: 0
2: 1
3: 9
4: 94
1148834995_1148835009 27 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835009 17:50461368-50461390 CTGGTGAGGAGGGGCTTGCTTGG 0: 1
1: 0
2: 2
3: 34
4: 386
1148834995_1148835007 17 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835007 17:50461358-50461380 GGGCATCATTCTGGTGAGGAGGG 0: 1
1: 0
2: 1
3: 14
4: 163
1148834995_1148835006 16 Left 1148834995 17:50461318-50461340 CCTATGCATGGGTGCTCATGCAG 0: 1
1: 0
2: 0
3: 6
4: 130
Right 1148835006 17:50461357-50461379 CGGGCATCATTCTGGTGAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148834995 Original CRISPR CTGCATGAGCACCCATGCAT AGG (reversed) Exonic
900990082 1:6094594-6094616 CTCCCTTAGCACCCAGGCATCGG - Intronic
901789488 1:11646857-11646879 CCCCATGAGCTCCCATGCTTAGG - Intergenic
904254983 1:29249200-29249222 CTGCATGTGGACACATGCATGGG + Intronic
908392083 1:63692747-63692769 CTGCATAAGCACTCATGTGTTGG + Intergenic
912963641 1:114217920-114217942 CTCCCTGAGCACCTGTGCATTGG - Intergenic
913156500 1:116104730-116104752 CTACATAAGCACCCATGGGTTGG - Intergenic
914462100 1:147894573-147894595 CTGCATCAGCAACCAAACATGGG + Intergenic
916586725 1:166155879-166155901 CAGCCTGAGCCCCCATGCAGAGG + Intronic
916840368 1:168594341-168594363 ATGCATGAGATGCCATGCATTGG + Intergenic
918086779 1:181252277-181252299 CTGCAGGAGCATCCATCCAGGGG - Intergenic
921707196 1:218336486-218336508 CTGCAAGGCCACCCACGCATAGG - Exonic
1065183326 10:23148395-23148417 ATGCATGCGCACACATGCACAGG - Intergenic
1071169829 10:82851285-82851307 CTCCAAGAGCACCAATGCTTAGG - Intronic
1071429640 10:85596588-85596610 CTGCTTGTGCACCCCTGCAGTGG - Intergenic
1071599463 10:86950897-86950919 ATGCATGTGCACGCATCCATAGG - Intronic
1071971828 10:90915696-90915718 CTGCAAGGGCACCCAGGCTTGGG + Intronic
1073472374 10:103730943-103730965 CTGAATGTGCACCCAGGCAGGGG + Intronic
1077328988 11:1975761-1975783 CTGCCTGGGCACCCATGCTGAGG - Intronic
1078188402 11:9071890-9071912 GAGCCTGAGCACCCATGAATAGG + Intronic
1079596563 11:22256858-22256880 ATGCATGAACACGCATACATTGG + Intronic
1085155223 11:74287135-74287157 CTGCAAGATGCCCCATGCATTGG + Intronic
1086930932 11:92692214-92692236 CAGCTTTAACACCCATGCATTGG + Intronic
1202811967 11_KI270721v1_random:30940-30962 CTGCCTGGGCACCCATGCTGAGG - Intergenic
1092121407 12:6046605-6046627 GTGCGTGTGCACCCAGGCATGGG - Intronic
1092467543 12:8746706-8746728 CTCCAGGAGCACCCATGGGTAGG - Intronic
1095777884 12:46029358-46029380 CTCCATGAGAACCAATGCCTGGG - Intergenic
1096355510 12:50937908-50937930 GTCCATGGGCAGCCATGCATGGG + Intergenic
1097125278 12:56769495-56769517 CTTCATAATCACACATGCATAGG - Intronic
1098414154 12:70214643-70214665 CTGCATGGGTAGGCATGCATAGG + Intergenic
1098962660 12:76755067-76755089 CCCCCTGAGCACCCATACATGGG - Intergenic
1100980056 12:100156688-100156710 CTCCAGGAGCACCCAGGCTTGGG - Intergenic
1101750944 12:107581801-107581823 CAAAATGAGCACCCACGCATGGG - Intronic
1103205096 12:119122780-119122802 CCCCATGACCACCCATGCACAGG - Intronic
1105444220 13:20438542-20438564 TGGCATGAGCACACATGCCTTGG - Intronic
1105988713 13:25595896-25595918 CTGAATGAGGACACATGTATTGG - Intronic
1106705382 13:32274066-32274088 CTGCACAAGCATCCACGCATTGG + Intronic
1107893278 13:44932848-44932870 CTGAATGAGCAGCAATGAATGGG - Intergenic
1109450915 13:62512959-62512981 CTGCAGGAGCAGCCAGGCAGGGG + Intergenic
1116955172 14:50915954-50915976 CTGGGTGAGCTCCCATGCCTGGG + Exonic
1119235762 14:73017942-73017964 CTGCACGGCCTCCCATGCATTGG + Intronic
1128102743 15:65017058-65017080 ATGCATGAGCTACCATGCCTAGG + Intronic
1128450589 15:67803912-67803934 CTGCCTGAGCTCCCAGACATGGG - Intronic
1129714255 15:77837831-77837853 CTGCATGCGCACCCAGGCCAGGG - Intergenic
1130275979 15:82476549-82476571 CCCCAGGAGCACCCAGGCATGGG - Intergenic
1130468340 15:84203941-84203963 CCCCAGGAGCACCCAGGCATGGG - Intergenic
1130485408 15:84395815-84395837 CCCCAGGAGCACCCAGGCATGGG + Intergenic
1130495926 15:84469601-84469623 CCCCAGGAGCACCCAGGCATGGG + Intergenic
1130590633 15:85208539-85208561 CCCCAGGAGCACCCAGGCATGGG - Intergenic
1132725628 16:1337109-1337131 CTGCACCTGCACCCATGCAGAGG + Intronic
1136489612 16:30598302-30598324 CAGCATGAGCATGCCTGCATTGG + Intergenic
1137595563 16:49721318-49721340 ATGAATGAACACCCATGCACAGG + Intronic
1138342055 16:56296471-56296493 CTGCATGAACAGGCATGCAGAGG + Intronic
1140167534 16:72568995-72569017 CTGCATGACCACATATACATAGG + Intergenic
1141094901 16:81156139-81156161 CTGCATGCTCACCTTTGCATCGG + Intergenic
1144135343 17:12289818-12289840 CTCCAAGAGCATCCTTGCATTGG + Intergenic
1144664577 17:17093261-17093283 CTGCATGAACTCTCCTGCATTGG + Intronic
1146459448 17:33033805-33033827 ATGCATGGGCACCCATGGGTGGG - Intronic
1147807757 17:43144284-43144306 CTGAATGAACATTCATGCATGGG + Intergenic
1147951330 17:44109561-44109583 CTGCATGGGCATCCCTGCCTGGG + Intronic
1148834995 17:50461318-50461340 CTGCATGAGCACCCATGCATAGG - Exonic
1149114331 17:53073769-53073791 AGGCATGAGCCCCCATGCCTGGG + Intergenic
1149853240 17:60054316-60054338 CTGCATGGGCACCCAGGCTTAGG - Intronic
1150825330 17:68469510-68469532 TTTCATGAGCACCTATACATGGG - Intergenic
1152902134 17:82948389-82948411 CTGCGTGAGCATCCCTGCCTCGG - Intronic
1154396387 18:13993888-13993910 CTGCAAGATCACACAGGCATGGG + Intergenic
1154413528 18:14157888-14157910 AGGCATGAGCCACCATGCATAGG + Intergenic
1158198073 18:54910464-54910486 CTCCATGGGCAGCCATGAATGGG + Intronic
1159370229 18:67518903-67518925 CTGCTTCAGCACAGATGCATGGG - Intergenic
1160737734 19:671819-671841 CTGCACGAGCACCCATTGACTGG + Intergenic
1164565109 19:29320291-29320313 CTGCAGGAGATCCTATGCATTGG + Intergenic
1164829052 19:31306533-31306555 GCGCATGTGCACTCATGCATGGG + Intronic
925658726 2:6179980-6180002 ATGCATGCACACACATGCATGGG + Intergenic
927826384 2:26312675-26312697 CTGCATGCGCACACACGCCTCGG + Intronic
928945731 2:36770428-36770450 CTGCATCAGCTCCTCTGCATGGG - Intronic
932988714 2:76760455-76760477 CTTCATAAGCACCCATTCTTTGG - Intronic
933117943 2:78497991-78498013 CTGCCTGAGCACACATGCACTGG - Intergenic
940003743 2:148992921-148992943 CTCCATGAGTACCCTTGCCTTGG - Intronic
940408464 2:153332782-153332804 CATTCTGAGCACCCATGCATTGG - Intergenic
943549080 2:189316386-189316408 CTGCATGAGCTCCCATTTATAGG - Intergenic
946877422 2:224143724-224143746 TTCCAGAAGCACCCATGCATGGG - Intergenic
1169241680 20:3986622-3986644 CTGCATGCACACTCATGCCTGGG - Intronic
1172043783 20:32064686-32064708 CTGCCTGAGCATCCATCCAGTGG - Intronic
1178358908 21:31932030-31932052 ATGCATGTGCACGCATCCATGGG - Intronic
1179651345 21:42811145-42811167 ATGAATGTGCACCCATGCAGGGG + Intergenic
1180144671 21:45912607-45912629 CTGCATGAGCCTCCCTGCACTGG - Intronic
1180161302 21:45999759-45999781 CTACAGGAGCACCCATGGACAGG - Intronic
949327990 3:2888567-2888589 CTGCATGTGCAACCCTTCATGGG - Intronic
951852572 3:27158621-27158643 GTGCATAAGAACCCATACATCGG + Intronic
953799340 3:46010140-46010162 ATGCATGAGCCCACATGCAGGGG + Intergenic
954139557 3:48597865-48597887 CTCCATGAGCACCCAGGGTTGGG + Intergenic
956134271 3:66083379-66083401 CTGAATGAGAACCCAAGCCTTGG + Intergenic
956787363 3:72653728-72653750 CCTCAGGAGCACCCAGGCATGGG + Intergenic
959050923 3:101524520-101524542 CTGCCTGAACACCTTTGCATAGG - Intergenic
960353488 3:116622193-116622215 ATGAATGACCACACATGCATGGG + Intronic
960485775 3:118251297-118251319 TTGCATGGGCTCCCATGCAAGGG + Intergenic
962270994 3:133978113-133978135 CTTCATGGGCACCCCTCCATGGG - Intronic
969671817 4:8593878-8593900 CTGCATGAGCACACACGCAGCGG - Intronic
977764188 4:100777683-100777705 CTGCATCATGACCCATGCATAGG + Intronic
980725811 4:136758917-136758939 AGGCATGAGCCACCATGCATTGG - Intergenic
982361155 4:154520548-154520570 AGGCATGAGCAACCATGCCTGGG + Intergenic
983150990 4:164281395-164281417 CTGCCTGAGCACCTGTGGATGGG + Intronic
985848138 5:2369341-2369363 ATGCATGCACACACATGCATGGG + Intergenic
989129725 5:38095092-38095114 TTGCAGGAGCCCACATGCATGGG + Intergenic
989796857 5:45484861-45484883 GTGCATGAGCTCACATTCATGGG + Intronic
996709917 5:126534179-126534201 CTGGCTGAGCCCCTATGCATTGG - Intergenic
1002700407 5:181120338-181120360 CTACTAGAGCAACCATGCATAGG - Intergenic
1005938746 6:30545381-30545403 CTGCATGAGCCCCCAGGATTTGG + Exonic
1006411652 6:33877433-33877455 CTGCATGCACACGCATGCAGTGG + Intergenic
1006946526 6:37788107-37788129 CAGCATGGGTACCCATGTATGGG - Intergenic
1009243250 6:61204244-61204266 ATGCATGAGCATGCAAGCATGGG + Intergenic
1015016713 6:128422205-128422227 CTGCATGTGTGCACATGCATGGG + Intronic
1019601850 7:1888603-1888625 ATGCATGCTCACACATGCATAGG - Intronic
1020220716 7:6234556-6234578 CTTCATGAGCATCCAGGCCTTGG - Intronic
1020250656 7:6465626-6465648 CGGCCTGACCACCCATGAATGGG + Intronic
1021456041 7:20830628-20830650 AGGCATGAGCAACCATGCCTGGG - Intergenic
1022348049 7:29537684-29537706 CTGCAGGAGCACCCATGGTGGGG + Intergenic
1026260694 7:68752836-68752858 CTGTATGAGCATCCAGGCCTAGG - Intergenic
1027422974 7:78035147-78035169 CCGCATCAGCACCCATGCCAGGG - Intronic
1030764635 7:113393978-113394000 CTGAATTAGCATCCATGCACAGG + Intergenic
1034734646 7:153417242-153417264 CAACAGGAGCTCCCATGCATGGG + Intergenic
1035271130 7:157720570-157720592 CCGCGTGCACACCCATGCATCGG - Intronic
1035368878 7:158366116-158366138 GTGCATGTGCACGCGTGCATTGG - Intronic
1035368892 7:158366235-158366257 GTGCATGTGCACGCGTGCATTGG - Intronic
1036064213 8:5359647-5359669 CTGCATGAACTCCCAGCCATAGG + Intergenic
1037744521 8:21632112-21632134 CTGGATAACCACCCAGGCATCGG + Intergenic
1042712897 8:71737937-71737959 CTGCATGAGCACATATGAGTTGG - Intergenic
1045559071 8:103243633-103243655 CTGCCTAAGCAGACATGCATGGG - Intergenic
1047023852 8:120806356-120806378 CTTCATGTGCAGCCGTGCATTGG + Intronic
1047335678 8:123933545-123933567 GTGCATGTGCACACATGCACAGG + Intronic
1053162208 9:35820967-35820989 CTGTATGAGGCCCCATGCAGTGG + Intronic
1056530445 9:87482335-87482357 CTTCAGGAACACCTATGCATTGG + Intergenic
1061193061 9:129093513-129093535 CTGCATGAGCAGCCAGGAGTGGG - Intergenic
1061310933 9:129762015-129762037 ATGCATGGGCAGCCAGGCATGGG - Intergenic
1062315183 9:135963654-135963676 CTTCATGAGCTCCTCTGCATGGG - Intergenic
1193227298 X:78998695-78998717 CTGAATGAGAACCCCTGAATAGG + Intergenic
1195715719 X:107816917-107816939 GTGCATGTGCACACGTGCATGGG + Intergenic
1198506296 X:137304278-137304300 CTGCATGAGGATCAATCCATTGG + Intergenic