ID: 1148835598

View in Genome Browser
Species Human (GRCh38)
Location 17:50464141-50464163
Sequence CTGAATGAGCTGTAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835588_1148835598 28 Left 1148835588 17:50464090-50464112 CCAGGTGTAGGAAAGGCTCGGGG 0: 1
1: 0
2: 2
3: 8
4: 104
Right 1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835598 Original CRISPR CTGAATGAGCTGTAGGTGAA AGG Intronic
900411145 1:2513259-2513281 GTGACTGAGCAGTGGGTGAAGGG + Intronic
900893017 1:5463326-5463348 CTGAAAGAGATGCAGGTGACAGG - Intergenic
902645283 1:17793593-17793615 CTGGAAAAGCTGTAGGGGAAGGG - Intronic
903086857 1:20868878-20868900 CTGAGTGACCTGTATGTGGATGG - Intronic
903417333 1:23192902-23192924 CTGAAAGAGCTGTGGGTGGTGGG - Exonic
904315357 1:29656494-29656516 ATGAATGAGCCTTGGGTGAAAGG - Intergenic
905693682 1:39960246-39960268 CTGGATGGGCTGGAGATGAAAGG - Intronic
905694456 1:39964738-39964760 GTGAATGAGGTGTGTGTGAATGG + Intronic
905791896 1:40794138-40794160 CCGAGTGAGCTCCAGGTGAAGGG + Intronic
906953007 1:50349615-50349637 CTGAATGAGCTGGAGAAGAGTGG - Intergenic
908219758 1:61993297-61993319 CAGATTGAGGTGTAAGTGAAGGG + Intronic
908471529 1:64448741-64448763 CTGAAATAGCTGGAGGAGAAGGG + Intergenic
909162549 1:72172081-72172103 ATGAATCAGCAGTAGGTGGAAGG + Intronic
910174269 1:84412403-84412425 GTGAATGAGCTCCTGGTGAAAGG - Exonic
910720488 1:90280830-90280852 CTGAATGAGCTTATGGTGAGAGG - Intergenic
912323268 1:108734566-108734588 TTGAATGATATGTAGGTGACAGG + Intronic
913370302 1:118091820-118091842 ATGCAGGAGCTGTAGGTGAAGGG + Intronic
913482619 1:119303499-119303521 CTGGATGAGCTGTGCCTGAAAGG - Intergenic
913986622 1:143571444-143571466 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914205023 1:145519231-145519253 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914370551 1:147020997-147021019 CTGAATGAGCTTTTGGTAGAGGG - Intergenic
914484144 1:148092413-148092435 CTGAATGAGCTTTTGGTAGAGGG + Intergenic
914895952 1:151673214-151673236 CTGAATGACCAGTGGGTCAATGG - Intronic
915476428 1:156155309-156155331 CTGTAGGAGTTGTAGGTGACTGG + Intronic
917732023 1:177884069-177884091 CTGCATGAGCTGTCAGTGCAAGG - Intergenic
919588740 1:199472348-199472370 GTGAATGAGTTGAAGCTGAAAGG + Intergenic
920602532 1:207343423-207343445 CTGAATGACCATTAGGTCAAGGG - Intronic
920949245 1:210557061-210557083 CTGAATGAGCTGGAGGAGCATGG + Intronic
921383599 1:214549517-214549539 CTTAATGAGCGGGAGCTGAATGG - Intronic
922006468 1:221535432-221535454 CAGAATGATCTGTTGGTAAAAGG - Intergenic
923817531 1:237397651-237397673 CTGAGTGACCTGTAGGGGTAGGG + Intronic
924630238 1:245731179-245731201 CTGAATGATCAGTGGGTAAATGG + Intergenic
1069623138 10:69850080-69850102 CTGGGTGAGCTGGAGGTGGAGGG + Intronic
1069910473 10:71755695-71755717 CTGCCTGAGCTGTAGGTGACAGG - Intronic
1070865835 10:79707716-79707738 CTGCCTGGGGTGTAGGTGAAAGG + Intronic
1071717134 10:88108304-88108326 CTGAATTAGCTGTTGGGGGAGGG + Intergenic
1072904951 10:99444546-99444568 CTGACTAAGCTGCAGGAGAAGGG + Intergenic
1072984485 10:100128006-100128028 CTGAAGGAGCTGGAGCTGCAGGG + Intergenic
1074003109 10:109392155-109392177 ATGAATGAGCTGAAGAAGAATGG + Intergenic
1075322044 10:121499295-121499317 CTGAATTAGCTTGAGGTGGAGGG - Intronic
1075672231 10:124270519-124270541 ATGGATGAGCTTTAGGTGAAGGG - Intergenic
1075923428 10:126232158-126232180 ATGAAGGAGCTGGAGATGAAGGG + Intronic
1076940279 10:133601257-133601279 CTAAATAATCTGTAGGTCAAAGG - Intergenic
1077593513 11:3511573-3511595 CTGACTGAGCTATAGGCGAGGGG + Intergenic
1077840627 11:5971041-5971063 CTGAATGAGCTGTGGGCCAGAGG + Intergenic
1078601475 11:12735315-12735337 CTGAATAAGCATTAGGGGAAGGG + Intronic
1081029002 11:38054139-38054161 CTGACTGAAGGGTAGGTGAAAGG - Intergenic
1081061042 11:38477917-38477939 CTGAAACAGCTGGAGGTGAGTGG + Intergenic
1082285659 11:50315472-50315494 GTGAATGAGCTGAATGTGGAAGG + Intergenic
1083649461 11:64193078-64193100 GTCAATGAGCTGAAGGAGAAAGG + Exonic
1084823471 11:71711180-71711202 CTGACTGAGCTATAGGCGAGGGG - Intergenic
1085016033 11:73174614-73174636 GTGATTGTGCTGTAGGTGCATGG + Intergenic
1085370394 11:75998462-75998484 CTGCCTAAGATGTAGGTGAAAGG + Intronic
1085519561 11:77130145-77130167 CTGACTGAGCAGAAGGTCAAGGG - Intronic
1087386255 11:97472055-97472077 CTGGATGAGATGTGGCTGAAGGG + Intergenic
1089050568 11:115541782-115541804 ATGACTGCGGTGTAGGTGAAAGG - Intergenic
1090385645 11:126356224-126356246 CTGACTGTGCTGGAGGTGACAGG + Intronic
1090762494 11:129849588-129849610 CTGTATGAGCTGTGGGAGCACGG - Intronic
1091334202 11:134754344-134754366 CTGAATGAGCAGAAGGAGCAAGG - Intergenic
1091690247 12:2591337-2591359 CTGTATAAGATGAAGGTGAAGGG - Intronic
1092125765 12:6074035-6074057 CTGAAAGGGTTTTAGGTGAAGGG - Intronic
1092419631 12:8319710-8319732 CTGACTGAGCTATAGGTGAGGGG + Intergenic
1094465801 12:30753541-30753563 CTGAATGGCCTGAAGGTGACTGG + Exonic
1095412678 12:41941278-41941300 CTGAATGAGGTGAAGTTAAAGGG + Intergenic
1096138880 12:49225842-49225864 TTGAATGAACTGTACTTGAATGG + Intronic
1097373222 12:58809646-58809668 CTGAATCAGCTGTTCGAGAAGGG - Intronic
1097706822 12:62877378-62877400 CTGACTGCTCTGTAGGTGAGGGG - Intronic
1097788583 12:63789143-63789165 ATGAATGCCCTCTAGGTGAAAGG - Intronic
1099193389 12:79584157-79584179 CTGAAGTATCTGCAGGTGAAAGG + Intronic
1101173024 12:102119766-102119788 TTTAATGAGCAGTAGGTGTAGGG - Intronic
1102873800 12:116434392-116434414 GGGAATGAGCTGTGGGTGGAGGG - Intergenic
1103826480 12:123743173-123743195 CTGAATGCGCCGGAAGTGAATGG - Intronic
1104088936 12:125498404-125498426 CTGACTGATCTGCAAGTGAAGGG - Intronic
1105726590 13:23168518-23168540 CTGAATTAGCTGTATGGCAAAGG - Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1112927368 13:104693189-104693211 CTGAAGCAGCTGGAGGTGATTGG - Intergenic
1113774682 13:112936461-112936483 GTTAATGAGCTTTGGGTGAAAGG + Intronic
1114856699 14:26455213-26455235 CTGAGTGAGCAATGGGTGAAAGG - Intronic
1117327827 14:54685037-54685059 CTGAAAAAGATTTAGGTGAATGG + Intronic
1120527101 14:85589907-85589929 GTGGATGCGCTGTAGGTGAGTGG + Intronic
1121225304 14:92317496-92317518 CTGAATGAGTGGTGAGTGAAGGG + Intergenic
1121848746 14:97199234-97199256 CTGAAGGAGTGGTAAGTGAATGG - Intergenic
1122199659 14:100114713-100114735 CAGAGTGAGCTGTAGGTGATGGG + Intronic
1122435321 14:101691352-101691374 AGGAATGGGCTTTAGGTGAAAGG - Intergenic
1126362500 15:47860906-47860928 CTGAATGAGCTGCACTTAAAGGG + Intergenic
1126887375 15:53165180-53165202 CTGAAAGAGTGGTGGGTGAAAGG + Intergenic
1128894678 15:71361640-71361662 GTGAAATAGCTGTAGGTAAAAGG - Intronic
1129888475 15:79055295-79055317 CTGAGTGGGCTCTAGGAGAATGG - Intronic
1131522237 15:93125412-93125434 CTGAATGGGCAGTAAGGGAAAGG + Intergenic
1136061695 16:27731042-27731064 CACAACCAGCTGTAGGTGAAGGG - Intronic
1137293434 16:47067948-47067970 CTTAATGAGTTGGAGATGAAAGG - Intergenic
1139027050 16:62831429-62831451 CTAAATGTGCTGAAGGTTAAAGG + Intergenic
1139061552 16:63259232-63259254 CTGAATGAGCAAAAGCTGAAAGG - Intergenic
1140239946 16:73191680-73191702 CTGAAAGAGCCGTGGGTGAGAGG - Intergenic
1140856144 16:78979496-78979518 CTGAATTAGAGGCAGGTGAAAGG + Intronic
1142169593 16:88614786-88614808 CTGTGTGTGCTGTAGGGGAAGGG - Intronic
1142928495 17:3261614-3261636 CAGAAGGAGCTCCAGGTGAAGGG - Intergenic
1145069567 17:19791975-19791997 CTGAATGACCAGTGGGTCAATGG + Intronic
1146394809 17:32456336-32456358 CTGAGTGAGCTCTAGGTTATGGG - Intronic
1148835598 17:50464141-50464163 CTGAATGAGCTGTAGGTGAAAGG + Intronic
1150666062 17:67139741-67139763 CTGTAAGAGCTGTGGGGGAAAGG - Intronic
1150851977 17:68712140-68712162 CTGACTGAGATGTGGGTGCAGGG + Intergenic
1153559428 18:6356728-6356750 GTGAATGAGCGGTGAGTGAATGG + Intronic
1155398182 18:25408500-25408522 CTGAAGGAGATGTGGGGGAAAGG - Intergenic
1156692124 18:39720778-39720800 CTCAAGGAGATCTAGGTGAATGG + Intergenic
1158012825 18:52748509-52748531 CTGAATGAGCTGTAACACAAAGG - Intronic
1160138210 18:76293336-76293358 CTGAATGACCAGTGGGTCAATGG - Intergenic
1166566474 19:43768641-43768663 TTGTATGAGCTGTAGTTGGAAGG + Intronic
1167153375 19:47722957-47722979 CTGAGTGAGCTCTAGCTGGAGGG + Intronic
1167508572 19:49883880-49883902 CTGCATGGGCTGTTGGGGAATGG + Intronic
925674532 2:6346954-6346976 CTGAATTACCTGGAGGTGGAAGG + Intergenic
926350249 2:11987466-11987488 TTGACTGAGCTGGAGGTGACTGG + Intergenic
928783872 2:34857812-34857834 CTGAATGATCAGTAGGTCAGTGG + Intergenic
929418941 2:41771329-41771351 TTGAATCAGCTGAAGGTGACTGG - Intergenic
930783989 2:55252402-55252424 CTAAATGAGCTATATGTAAATGG + Intronic
931427397 2:62183734-62183756 GTGAAGGAGCTGGATGTGAAGGG + Intergenic
932451351 2:71812727-71812749 CTGGAAGAGCTGTAGGTGGGAGG + Intergenic
933035363 2:77390010-77390032 CTGAATGTGTTGTTTGTGAAAGG - Intronic
933941168 2:87246201-87246223 CTGAAAGAGCTGTGGGTGTCGGG + Intergenic
935598382 2:104897489-104897511 CTGAGTGGGCTGTAGGGGGAGGG - Intergenic
936351972 2:111719811-111719833 CTGAAAGAGCTGTGGGTGTCGGG - Intergenic
936541996 2:113359871-113359893 CTGAATGAGCGGTAGATTCAGGG - Intergenic
937060111 2:118974664-118974686 CTGAGGGGTCTGTAGGTGAACGG + Intronic
939092341 2:137793954-137793976 CTGAATGATCTATAGCTGGAAGG + Intergenic
941177562 2:162217385-162217407 CTGAGTGTGCAGTAGGAGAATGG - Intronic
941821746 2:169850519-169850541 CTGTAAGAGTTTTAGGTGAAGGG + Intronic
941942357 2:171054395-171054417 CTGCATGAGATGTTGGTCAAAGG - Intronic
944709906 2:202326518-202326540 CTGAATGAGGTGCAGGAGATGGG - Intergenic
945965528 2:216182433-216182455 CCAAATGAGCAGTAGGGGAAAGG - Intronic
946760971 2:222992774-222992796 CTGAGTGGCATGTAGGTGAACGG + Intergenic
1168840314 20:905858-905880 CTAAATGAGCTGTATTTGTAGGG - Intronic
1170518966 20:17163382-17163404 CAGAATGAACTGTAGGTGTGTGG + Intergenic
1170624682 20:18022068-18022090 ATGATTGAGGTGTAGGTGATGGG + Intronic
1170624745 20:18022373-18022395 ATGATTGAGGTGTAGGTGATGGG + Intronic
1170624755 20:18022431-18022453 ATGATTGAGGTGTAGGTGATGGG + Intronic
1170624854 20:18022893-18022915 ATGATTGAGGTGTAGGTGATGGG + Intronic
1170624935 20:18023231-18023253 GTGATTGAGGTGTAGGTGATGGG + Intronic
1170986761 20:21266090-21266112 CTGCATGTGCTGCAGATGAAGGG - Intergenic
1171210088 20:23310295-23310317 GTGGATGAGCTGAAGGAGAAAGG - Intergenic
1172342834 20:34172242-34172264 CTGACTTGGCTGTAGGAGAAAGG - Intergenic
1174171110 20:48618749-48618771 CTGAAGGAGCTGAAGGGGGAAGG - Intergenic
1177211088 21:18071439-18071461 CTGAAAGAGCTGTAGCTGGCCGG - Intronic
1182145220 22:27993268-27993290 CTGGGTGAGCTGTGGGTGTAGGG - Exonic
1183758150 22:39790073-39790095 CTGAATGTGCAGAAGGAGAAGGG + Intronic
949263282 3:2127231-2127253 CCCAATGTGCTGTGGGTGAAGGG + Intronic
951523719 3:23632810-23632832 CTGACTGGCCTGTAGGTTAAGGG - Intergenic
955251970 3:57292274-57292296 CTGAATAAGCTTTAAGTCAATGG - Intronic
961204524 3:125070734-125070756 GTGAGTGAGAGGTAGGTGAATGG + Intergenic
961852699 3:129837587-129837609 CTGAATGTGCTGTATATGACAGG - Intronic
963855415 3:150248442-150248464 CTGAATGAGCTCTCTGTGAAAGG - Intergenic
964208030 3:154196213-154196235 GAGAAAGAGCTGTAGCTGAAAGG + Intronic
964381660 3:156103812-156103834 TTGAATTAGCTCCAGGTGAAAGG + Intronic
964386163 3:156150171-156150193 CTGAATAGGCTGCTGGTGAAGGG + Intronic
964504629 3:157385267-157385289 ATGAATGAGATGTAGGAAAAAGG - Intronic
964600111 3:158490708-158490730 GTGATAGATCTGTAGGTGAATGG + Intronic
971519556 4:27531748-27531770 CTGAATGAAAAGTAGGTGTAGGG - Intergenic
974067394 4:57091756-57091778 CTGAATGTGCTGGAGATTAAAGG + Intronic
974798234 4:66781000-66781022 GTGAGTGAGTTGGAGGTGAATGG - Intergenic
976466555 4:85376108-85376130 GTGAATGAGGTTTAGGGGAATGG - Intergenic
976894909 4:90097559-90097581 CTGAAAGAGGTGAAGGAGAAAGG + Intergenic
978491175 4:109313775-109313797 CTGAATGGGCTGTGGGGGATTGG - Intergenic
985987220 5:3525977-3525999 CTTAATGAGATCAAGGTGAAGGG - Intergenic
987033489 5:13997021-13997043 GTGCATGAGCTGTGGGGGAATGG - Intergenic
988845135 5:35119963-35119985 CTGAATGAATAGTAGATGAATGG - Intronic
988879869 5:35490121-35490143 CTGGATCAGTTGTAGGGGAAAGG - Intergenic
991693366 5:69246847-69246869 CTGAATGACCAGTGGGTCAATGG - Intronic
992227457 5:74632910-74632932 CTAAATGAGCTGTAAGGGACAGG + Intronic
993909697 5:93666242-93666264 CTGAATAAGATGTAGGTGAAAGG - Intronic
993975037 5:94469013-94469035 ATCAATGAGATTTAGGTGAAGGG + Intronic
994380549 5:99065689-99065711 ATGAATGAAGTGTAGGTGAAAGG + Intergenic
994590451 5:101765506-101765528 TTGAATTGGCTGTAAGTGAAAGG - Intergenic
994889513 5:105613089-105613111 CAGAAGGATCTGAAGGTGAAGGG - Intergenic
995517647 5:112969797-112969819 CTGAAAGATCTGTAGGAAAATGG - Intergenic
1000162350 5:158611218-158611240 CTGAGAGAGCTGTAGCTGAGTGG + Intergenic
1000222896 5:159231221-159231243 CTGAATGAGGAGTTGGGGAAAGG - Intergenic
1000362258 5:160458663-160458685 CTAAATGTGCTCTAAGTGAAGGG - Intergenic
1000683372 5:164215386-164215408 ATGAATGAGCAGTAGGTGCTGGG + Intergenic
1000964997 5:167645788-167645810 CTGAAGGAGCTATATGTAAAAGG + Intronic
1001358488 5:171056900-171056922 CTGAATAAACTGTAGGAAAAAGG - Intronic
1001734113 5:173984802-173984824 CTGTATGAGCAGTATGAGAATGG - Intronic
1002937302 6:1684445-1684467 CCAAATGAGCTTCAGGTGAACGG + Intronic
1004933363 6:20483408-20483430 CTGATTGGGCTATAGTTGAAGGG + Intronic
1005589203 6:27307610-27307632 GGGAATGAGCTGTTGGTCAAAGG - Intronic
1005806722 6:29480274-29480296 CACAAACAGCTGTAGGTGAACGG - Intergenic
1009658383 6:66576051-66576073 CAGAATGTGCTGTAGCAGAATGG - Intergenic
1010606363 6:77893426-77893448 CTGAATGAGTTATAGTTGACAGG - Intronic
1011871685 6:91902167-91902189 CTGAATGAGCTCCTGGTCAAGGG - Intergenic
1013298836 6:108783812-108783834 CTGAAGGACCTGTAGGAGACAGG + Intergenic
1015528120 6:134192890-134192912 CTCAAAGAGGTGCAGGTGAAGGG - Intronic
1015564723 6:134557299-134557321 CTCACTTGGCTGTAGGTGAAGGG + Intergenic
1016389648 6:143561829-143561851 CTTCATGAGCTGGCGGTGAAGGG - Intronic
1017350672 6:153438230-153438252 CTGAGGGAGCTATAAGTGAATGG + Intergenic
1018146410 6:160894048-160894070 CTGAGGGAGCTATAAGTGAATGG - Intergenic
1018581461 6:165311594-165311616 CATAATGAGCTGCAGGTGAGGGG - Intergenic
1022142980 7:27509279-27509301 CCGTATGAGCTGAAGCTGAAAGG + Intergenic
1024316504 7:48023926-48023948 CTGAATTGGCTATAGTTGAATGG - Intronic
1024784439 7:52890943-52890965 CTGAATGAACTCTAGGTTACTGG + Intergenic
1026095005 7:67340095-67340117 CTCAATGAGCTCTAGGGGACGGG - Intergenic
1026283014 7:68938365-68938387 TTGAATGAGGAGTAGGTGAATGG - Intergenic
1026769164 7:73183174-73183196 CCGAATGATCTGTACGTGGAAGG + Intergenic
1027010033 7:74736559-74736581 CCGAATGATCTGTACGTGGAAGG + Intronic
1027078008 7:75209478-75209500 CCGAATGATCTGTACGTGGAAGG - Intergenic
1027123201 7:75537098-75537120 CGGAATGAACTGTCCGTGAATGG - Exonic
1028887116 7:95946648-95946670 ATGAATGAACTGTAAGTGTATGG - Intronic
1030128266 7:106175785-106175807 CTGAGTGGGATGTAGGGGAAAGG - Intergenic
1031835424 7:126675787-126675809 CTGAATGGGCAGAAGTTGAAAGG + Intronic
1032162726 7:129523128-129523150 CTGAATGAGCTGTGGGGGTCCGG + Intergenic
1032666817 7:134045071-134045093 CTAAATCAGGTGTATGTGAAAGG + Intronic
1034376398 7:150648764-150648786 CTGAATGAGGGGAAGTTGAAGGG - Intergenic
1035285907 7:157807130-157807152 CTGGCAAAGCTGTAGGTGAACGG + Intronic
1046071930 8:109266003-109266025 TTGAATGACCAGAAGGTGAAAGG - Intronic
1047682549 8:127269040-127269062 CTGAATGTTCTGTAGTTGGAGGG + Intergenic
1047946132 8:129882704-129882726 CAGAACGAGCTGTAGGAAAATGG - Intronic
1047952713 8:129948449-129948471 CTGAAAGAGCTGTTTGTGGAAGG - Intronic
1048322305 8:133409612-133409634 CTGGATGAGCTGTCGGTGTTTGG + Intergenic
1049296547 8:141843504-141843526 CTGAATGAGCAGCAGGAGCAGGG + Intergenic
1049657271 8:143804426-143804448 CTCAAGGAGCTGCAGGGGAAAGG + Intronic
1053103390 9:35390311-35390333 CTAAATAAGCTGGAGGAGAAAGG - Intronic
1053161506 9:35816639-35816661 TTGAATTAGTTTTAGGTGAATGG + Intronic
1053670067 9:40351867-40351889 CTGAATGAGCTTATGGTGAGAGG - Intergenic
1053919857 9:42978124-42978146 CTGAATGAGCTTATGGTGAGAGG - Intergenic
1054381190 9:64491866-64491888 CTGAATGAGCTTATGGTGAGAGG - Intergenic
1054514546 9:66024430-66024452 CTGAATGAGCTTATGGTGAGAGG + Intergenic
1055550540 9:77428521-77428543 CTGAATGAATTGGTGGTGAATGG - Intronic
1057697045 9:97330615-97330637 CTGAATGAGGAGAATGTGAAGGG + Exonic
1058397519 9:104571576-104571598 CTCAAAGATCTGTAGGTAAAGGG - Intergenic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1187377060 X:18764510-18764532 CTGAATAAGTTGAAGGTGGAAGG + Intronic
1193186259 X:78516420-78516442 CTGAATGGTCTACAGGTGAATGG - Intergenic
1195116095 X:101699348-101699370 CTGAATGACCAGTGGGTCAATGG + Intergenic
1197307935 X:124866400-124866422 CTGAATGACCAGTGGGTCAATGG + Intronic
1199324021 X:146476339-146476361 CTGAAGGAGCTGTTGGGGACAGG + Intergenic