ID: 1148835926

View in Genome Browser
Species Human (GRCh38)
Location 17:50465739-50465761
Sequence TCGCCCTTACCAATAACCCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 83}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835926_1148835930 -2 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1148835926_1148835935 10 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835935 17:50465772-50465794 GCTGTCGAAGGGGAAGTTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 150
1148835926_1148835934 7 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1148835926_1148835932 0 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1148835926_1148835931 -1 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
1148835926_1148835936 11 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 140
1148835926_1148835938 27 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835938 17:50465789-50465811 TGGAGGGTAGCTGGTTCAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 143
1148835926_1148835937 18 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835937 17:50465780-50465802 AGGGGAAGTTGGAGGGTAGCTGG 0: 1
1: 0
2: 1
3: 45
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835926 Original CRISPR TCGCCCTTACCAATAACCCC TGG (reversed) Exonic
911683462 1:100746092-100746114 TAGCCCTTGTCAATAACCCAGGG + Intergenic
922641740 1:227239250-227239272 TCTCCCTCACCACTGACCCCTGG - Intronic
922980318 1:229820528-229820550 TAGTCCTTACCCATAAACCCAGG - Intergenic
1063796371 10:9517706-9517728 TCGCCCTTCCCAGTGGCCCCTGG - Intergenic
1064591530 10:16897495-16897517 TTTCCCCTACCAATACCCCCGGG + Intronic
1070199472 10:74189755-74189777 TCTCCCTAACCTCTAACCCCTGG + Intronic
1073267845 10:102239130-102239152 TTGCCCTCACCAGCAACCCCTGG + Intronic
1090752957 11:129763550-129763572 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1094654788 12:32409727-32409749 TAAACCTTACCAGTAACCCCTGG + Intronic
1107260521 13:38484994-38485016 TCCCCCTTACCCCAAACCCCCGG - Intergenic
1118447723 14:65866989-65867011 TTGCCCTTCCCATTAACGCCAGG + Intergenic
1118535193 14:66756056-66756078 TCTCCTTTACCTCTAACCCCAGG + Intronic
1123472046 15:20562705-20562727 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123645957 15:22437648-22437670 CTGCCCTCACCAATCACCCCAGG - Intergenic
1123667266 15:22617502-22617524 TTGCCCTCGCCAATCACCCCAGG - Intergenic
1123732350 15:23157696-23157718 CTGCCCTCACCAATCACCCCAGG + Intergenic
1123750485 15:23355078-23355100 CTGCCCTCACCAATCACCCCAGG + Intronic
1124282854 15:28378994-28379016 CTGCCCTCACCAATCACCCCAGG + Intronic
1124299845 15:28532619-28532641 CTGCCCTCACCAATCACCCCAGG - Intronic
1124321107 15:28712069-28712091 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124481391 15:30083286-30083308 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124487846 15:30135382-30135404 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124522203 15:30413908-30413930 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124536462 15:30552310-30552332 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124542935 15:30604359-30604381 TTGCCCTCGCCAATCACCCCAGG + Intronic
1124755683 15:32402939-32402961 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124762189 15:32455282-32455304 TTGCCCTCGCCAATCACCCCAGG - Intronic
1124776440 15:32593786-32593808 TTGCCCTCGCCAATCACCCCAGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1129838269 15:78727447-78727469 CTGCCCTCACCAATCACCCCAGG + Intronic
1130260314 15:82349086-82349108 CTGCCCTTGCCAATCACCCCAGG - Intronic
1130268416 15:82430347-82430369 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130280919 15:82519921-82519943 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130472289 15:84236102-84236124 CTGCCCTTGCCAATCACCCCAGG + Intronic
1130479782 15:84350673-84350695 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130483914 15:84387106-84387128 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1130491988 15:84437456-84437478 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130503604 15:84516496-84516518 CTGCCCTTGCCAATCACCCCAGG - Intergenic
1130594587 15:85240738-85240760 CTGCCCTTGCCAATCACCCCAGG + Intergenic
1131058658 15:89391217-89391239 TAGCCCTTCAGAATAACCCCAGG + Intergenic
1133844238 16:9439301-9439323 TCTCCATTACCAAGAACCCCAGG + Intergenic
1138978512 16:62238314-62238336 ACCCCCTGACCAATAAACCCTGG - Intergenic
1139182582 16:64765523-64765545 TAGGCCCTGCCAATAACCCCTGG + Intergenic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1156865268 18:41882066-41882088 TCTCCCTTTCCAGTAACTCCTGG + Intergenic
1158650091 18:59276295-59276317 TAGCCCCTAACAATGACCCCCGG - Intronic
1163695294 19:18760727-18760749 TCGCCCGTCCCAATAGCTCCTGG + Intronic
1165493341 19:36138272-36138294 TGGCTCATGCCAATAACCCCAGG - Intergenic
1168501026 19:56893438-56893460 TCTCCTTTACCCATAGCCCCTGG - Intergenic
926259894 2:11249670-11249692 TGGCCTTTGCCAATAGCCCCTGG - Exonic
928253321 2:29700832-29700854 TCTCCCTTATCAAAACCCCCTGG + Intronic
937380141 2:121368977-121368999 TCTCCCTTCCCCACAACCCCTGG + Intronic
941129566 2:161629707-161629729 CCTCCCTTTCCACTAACCCCTGG + Intronic
941388581 2:164883383-164883405 ACTCCCTTCCCAATAACCCTAGG + Intergenic
942318163 2:174713182-174713204 TCGCCCCTACCCCCAACCCCTGG - Intergenic
942497147 2:176551830-176551852 TCACCCTTACCAATATGCGCTGG + Intergenic
950801317 3:15553977-15553999 TCTCCCTACCCAATCACCCCAGG + Intergenic
954999075 3:54910045-54910067 TTGCACTTACCAAGAACTCCTGG + Intronic
958983935 3:100758558-100758580 TCGATCTTTCCAATAACCCGTGG - Intronic
965517223 3:169634500-169634522 TCACCCTTACCAACAAGCCTTGG - Intronic
970166685 4:13245525-13245547 TCCCCCTTACAGATAAACCCTGG - Intergenic
978130411 4:105189280-105189302 TGGCATTTACCAAGAACCCCGGG + Intronic
980019447 4:127691014-127691036 CCTCCCTTTCCATTAACCCCTGG + Intronic
1000105884 5:158058343-158058365 TCTCCCTTACCAATTTCTCCCGG + Intergenic
1005728789 6:28675663-28675685 TCACCTTTACCCCTAACCCCTGG - Intergenic
1008167930 6:48163552-48163574 TCACCTTTACCAACAACCCAAGG - Intergenic
1010829080 6:80508965-80508987 TAGCCCTTAACAATAACTGCAGG - Intergenic
1014257186 6:119173044-119173066 TTGCCGTTTCCAATAACCCTAGG - Intergenic
1021984051 7:26081914-26081936 TGGCCCTGACCAAGAGCCCCAGG - Intergenic
1022291600 7:29009785-29009807 TTGCCCTTCCTAATTACCCCTGG - Intronic
1023540408 7:41258736-41258758 TCTCCCTCCCCACTAACCCCTGG + Intergenic
1027725643 7:81802178-81802200 TCCTCCTTACCCCTAACCCCAGG - Intergenic
1038577461 8:28717348-28717370 TCGCCCTCATCATTACCCCCGGG + Exonic
1042252992 8:66775141-66775163 CCGCCCTCACCAATCACCACCGG - Intronic
1052894514 9:33734803-33734825 TAGCCCTCCCCAATGACCCCTGG - Intergenic
1056965568 9:91160886-91160908 TCGCCCTCCCCAGTATCCCCTGG - Intergenic
1059915223 9:119092229-119092251 TTGACCTTTCCAATAACCCTGGG - Intergenic
1060457742 9:123816267-123816289 TGGCTCATACCTATAACCCCAGG - Intronic
1061510840 9:131060025-131060047 TCTCCCTTCCCAAGCACCCCAGG + Intronic
1189189132 X:39082269-39082291 TTGCCCCTACCTCTAACCCCTGG - Intergenic
1190118792 X:47643669-47643691 ATGCCCTTACCCAAAACCCCTGG - Intronic
1191776450 X:64819762-64819784 TCACCCTTCCCAATAGGCCCTGG - Intergenic
1201385970 Y:13439859-13439881 TCACCCATACCAACAAACCCAGG + Intronic
1202374163 Y:24218190-24218212 TTGCCCTTGCCAATCACCACAGG - Intergenic
1202496618 Y:25451930-25451952 TTGCCCTTGCCAATCACCACAGG + Intergenic