ID: 1148835930

View in Genome Browser
Species Human (GRCh38)
Location 17:50465760-50465782
Sequence GAGGGTCTCCAGGCTGTCGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835915_1148835930 28 Left 1148835915 17:50465709-50465731 CCGAAGGCCCCGGAGCTGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 357
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1148835926_1148835930 -2 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1148835917_1148835930 21 Left 1148835917 17:50465716-50465738 CCCCGGAGCTGGCAGGTACACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1148835919_1148835930 19 Left 1148835919 17:50465718-50465740 CCGGAGCTGGCAGGTACACTTCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145
1148835918_1148835930 20 Left 1148835918 17:50465717-50465739 CCCGGAGCTGGCAGGTACACTTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG 0: 1
1: 0
2: 1
3: 12
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835930 Original CRISPR GAGGGTCTCCAGGCTGTCGA AGG Exonic
900655529 1:3754954-3754976 GAGGGTCTCCACGGTGGCCAGGG + Intronic
901229251 1:7632897-7632919 GAGGTGCTCCAGGCTGCAGAGGG - Intronic
901466581 1:9425588-9425610 CAGGGTCTCCAGGCTCTGGAAGG - Intergenic
902323400 1:15683800-15683822 GAGGGTCTCCAGGGTCTCTGAGG + Intergenic
904209715 1:28878900-28878922 GAATGTATCCAGGCTGTGGAGGG - Intergenic
905206142 1:36343880-36343902 GAGGGCCTCCAGGACGTCGGCGG + Exonic
907898689 1:58717658-58717680 GTGGGTCTACAGGCTGTCCTGGG - Intergenic
907983158 1:59504645-59504667 GAGTATCTCAAGGCTGTTGAGGG - Intronic
910963262 1:92784362-92784384 GCGTGTCTCCAGGCTGCTGATGG - Intronic
913518363 1:119623668-119623690 GAAGGGCTCCAGGCTGGCGGCGG + Exonic
917638250 1:176957783-176957805 GAGAACCTCCAGGCTGTCGAAGG + Exonic
917704054 1:177613367-177613389 GAGGGTACCCAGGCTGTCTGGGG - Intergenic
920564371 1:206961678-206961700 AAGGGCCTCCAGGCTGTGAAAGG - Intronic
1063450776 10:6148538-6148560 GTGGGTCTCCAGGGTGACGGTGG + Intronic
1063827212 10:9911242-9911264 CAGGGTCTCCAGCTTGTGGATGG + Intergenic
1066457597 10:35585478-35585500 GAGGGTCGCCAGGCTGTGATGGG - Intergenic
1067224699 10:44368071-44368093 GAGGTTCTCCAGGCCCTCCATGG + Intergenic
1069255612 10:66328717-66328739 GTGGGTCTCCAGCCTGCAGAAGG - Intronic
1070694635 10:78552775-78552797 GATGGGCTGCAGCCTGTCGAGGG - Intergenic
1070808989 10:79288077-79288099 GAGGGTATCCAGGCAGGGGAGGG + Intronic
1072615007 10:97043378-97043400 GAGGGACTGGAGGGTGTCGAAGG + Exonic
1076029709 10:127147222-127147244 GATGTTCTCCAGCCTGTCTAAGG + Intronic
1076629348 10:131842941-131842963 CTGGGTCCCCAGGCTGTCGATGG - Intergenic
1083600889 11:63946941-63946963 GAGGGTCTCCAAGCTGTGGAGGG - Exonic
1083734696 11:64672726-64672748 AAGGGTCTCCAGGCTGAGTAAGG + Intronic
1083883244 11:65558490-65558512 GAGGGTGTGCAGGCTGGCGGAGG + Intronic
1084940505 11:72610223-72610245 ATGGGTCCCCAGGCTGTCCATGG - Intronic
1087618125 11:100511808-100511830 CTGGGTCTCCAGGCTGCAGACGG + Intergenic
1087708285 11:101520345-101520367 GAGGTTCTGCAGGCTGTACAGGG - Intronic
1088120662 11:106365165-106365187 GAGGGTCTTCAGGCTGGGCACGG + Intergenic
1089136835 11:116256036-116256058 GAGGCTCTCCTGGCTGGGGAGGG - Intergenic
1089835529 11:121367052-121367074 AAGAGTCTCCAAGCTGTTGATGG - Intergenic
1091406211 12:211087-211109 GAGGTGCCCCAGGCTGTAGAGGG + Intronic
1091796719 12:3301553-3301575 GAGGGTCTCTAGCCTTTGGAGGG - Intergenic
1100223159 12:92528502-92528524 CTGGGTCTCCAGGTTGTAGATGG + Intergenic
1104972215 12:132536995-132537017 GGGGGTCTTCAGGCTGACGTGGG + Intronic
1108551438 13:51549458-51549480 GAGGGTCTCCAGCCTGAAGGGGG + Intergenic
1116955738 14:50921207-50921229 GAGGGTCTCAGGGCTGCAGAGGG + Intronic
1121338753 14:93092769-93092791 GAGGGTGCCCTGGCTGTCGTGGG - Intronic
1122066089 14:99175292-99175314 GAGGGCCTCAAGGCGGCCGACGG - Exonic
1122171416 14:99878514-99878536 GAGTGTCTCCTGGGGGTCGAAGG + Exonic
1122892598 14:104739755-104739777 GATTTTCACCAGGCTGTCGACGG + Exonic
1123063794 14:105606248-105606270 GAGTGTTCCCAGGCTGTCCAAGG + Intergenic
1123804298 15:23855176-23855198 GAGGGTCTGCTGGCAGTCAAGGG + Intergenic
1124401725 15:29354310-29354332 CAGGGTCTCCAGCCTGGAGATGG + Intronic
1124610376 15:31203921-31203943 CAGGGTCTCCAGCATGTCGATGG - Intergenic
1125242264 15:37588769-37588791 GGTGGTCTCCAGGCTGCCTAAGG + Intergenic
1128249209 15:66152862-66152884 GAGGGTATCCAGGCTGAAGGAGG + Intronic
1128370103 15:67034065-67034087 CAGGGTCCCCAGCCTGCCGATGG - Intergenic
1134202888 16:12213598-12213620 GAGAGTGTCCAGGCTGTGGAAGG + Intronic
1139365711 16:66432272-66432294 GAGGGTATCCACGCTGGCCAAGG + Intronic
1139878261 16:70163715-70163737 CAGGGTCTCCAGGGTGTGGCAGG + Intergenic
1140359302 16:74331099-74331121 CAGGGTCTCCAGGGTGTGGCAGG - Intergenic
1141010060 16:80388855-80388877 GAGGGTCTCCTGGCTTTGGTGGG - Intergenic
1141173177 16:81703973-81703995 GAGGTTCTCCAGGTTTCCGAAGG - Exonic
1141592296 16:85077119-85077141 CAGGGTCTGCAGGCAGGCGAGGG - Intronic
1143755975 17:9067832-9067854 CAGGGCCTCCTGGCTGCCGAGGG - Intronic
1144791421 17:17861519-17861541 GAGGATCCTCAGGCTGTCGGAGG - Exonic
1145857828 17:28179438-28179460 GAGGGTCTCCCGGCTGGGAATGG + Intronic
1147701743 17:42400468-42400490 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1148835930 17:50465760-50465782 GAGGGTCTCCAGGCTGTCGAAGG + Exonic
1149086553 17:52724378-52724400 TAGGGTCTCCAGCTTGTAGAAGG + Intergenic
1149549875 17:57532276-57532298 GAGGGGCTGCAGCCTGTGGAGGG + Intronic
1151559843 17:74864362-74864384 GAATGTCTCCAGGCTGTCCCTGG + Intronic
1151726960 17:75890923-75890945 CTGGGGCTCCAGGCTGTAGAAGG + Exonic
1151804349 17:76396465-76396487 GAGGCTCTCCAGGATCTTGATGG + Exonic
1152073793 17:78146806-78146828 GTGGGTCTCGAGGCTGTCTCTGG + Intronic
1152600033 17:81257689-81257711 GAGGGTCTGCTGGGTGTCGACGG - Intronic
1156659018 18:39323642-39323664 CAGGGTCTCCAGGTTGCAGATGG + Intergenic
1157699645 18:49753016-49753038 GGAGGTCTCCAGGCTGGAGATGG + Intergenic
1159923661 18:74247966-74247988 GAGGGTCACCAGGCTCTGGGGGG - Intergenic
1160683198 19:422020-422042 GAGGGTCTCAAGGGTCTCGAGGG - Intronic
1160798166 19:955188-955210 GACGGTGTCCAGGCTGCCCATGG - Intronic
1160898096 19:1412239-1412261 GAGGGAGTCCAGGCTATGGAGGG + Intronic
1161270470 19:3386888-3386910 TAGGGTCCCCAGGCTGTGGCTGG + Intronic
1164445884 19:28317229-28317251 GAAGGGCTCCAGGCTGGCGAGGG - Intergenic
1165093872 19:33400259-33400281 GAGGGACTCCAGGCTGCAGAAGG + Intronic
1165246364 19:34500539-34500561 GTGGGTCACCAGGCTGGAGAGGG + Exonic
1165480400 19:36060091-36060113 GAGTATCTCCAGGCTGTGTAGGG - Intronic
1166310385 19:41959142-41959164 CTGGGACTCCAGGCTCTCGAGGG + Intronic
1167630210 19:50621716-50621738 GAGGGACTTCAGGCTGTTCAAGG - Intronic
925007224 2:453137-453159 GTGGGTTTGCAGGCTGTCGTGGG - Intergenic
936247330 2:110839789-110839811 GAGGATCCCCAGGCTGTGGGAGG - Intronic
938845340 2:135202853-135202875 GAGAGTCTGCAGGTTGTCCAGGG + Exonic
944146635 2:196513996-196514018 GTGGGTCTCCAGCCTGTTGCTGG - Intronic
1169270498 20:4195640-4195662 GAGGTTCTTCAGGCTGCAGATGG + Intergenic
1175791987 20:61745671-61745693 CAGGGTCCCCAGGCTGTCCAAGG - Intronic
1179457713 21:41510531-41510553 CTGGGTCTCCAGTCTGTAGATGG - Intronic
1180756584 22:18166135-18166157 GAGGTTCTCCAGACTGAGGACGG - Intronic
1181075185 22:20371298-20371320 GAGGTTCTCCAGACTGAGGACGG + Intronic
1181582777 22:23837231-23837253 CAGGGCCACCAGGCTGTGGATGG - Intronic
1182697490 22:32206620-32206642 GAGGGACTCCAGTCTCTAGAGGG + Intergenic
1183403550 22:37618753-37618775 GAGTGTTTCCAGGCTGGCCAGGG + Intronic
1184681548 22:46074841-46074863 AAGGGTCTCCAGGGTGCTGATGG + Intronic
1184790305 22:46695922-46695944 GAGGGGCCCCAGGGTGTCGTGGG + Intronic
1185046157 22:48529639-48529661 GAGGGTGTCCAGGCAGGAGATGG + Intronic
950578240 3:13846007-13846029 GAGGGGCCCCAGGCTGTCATGGG - Intronic
952287245 3:31981044-31981066 GGGGGTCTCCAGCCGGTCGGCGG - Exonic
953826597 3:46257786-46257808 CAGGGTCTCCAGCTTGTAGATGG - Intronic
954819368 3:53312268-53312290 CAGCATCTCCAGGATGTCGATGG + Exonic
959600636 3:108180304-108180326 GAGAGTTTCCAGGCTTTAGAAGG + Intronic
961219320 3:125187369-125187391 GAGGGCCACCAGGATGACGAAGG + Exonic
961823739 3:129588140-129588162 GAGGGGCTCCAGGCTGTGGCGGG + Intronic
962638013 3:137350714-137350736 AAGGGTCTCCAGGGTGTCCCTGG + Intergenic
967279607 3:187809017-187809039 GAGTGTCTCCAGGCTGGTAAAGG - Intergenic
972712689 4:41613581-41613603 AAAGGAATCCAGGCTGTCGAAGG - Exonic
976922689 4:90457874-90457896 ATGGGTCTGCAGGCTGTGGATGG - Intronic
979027129 4:115591991-115592013 CAGGGTCTCCAGCTTGTAGATGG - Intergenic
981953977 4:150447551-150447573 CAGGGTCTCCAGCCTGCAGATGG + Intronic
990327273 5:54690966-54690988 GAGTGATTCCAGGCTGTGGAAGG - Intergenic
992738227 5:79745391-79745413 GATGGTCTCCAGGGTGTCTTTGG - Exonic
995117704 5:108500459-108500481 GAGTGTCTCAAGGCTGTGTAGGG - Intergenic
999146273 5:149397739-149397761 CAGGGTCTCCAGCTTGTAGACGG - Intronic
1001466897 5:171975390-171975412 CAGGATCTCCAGGCTGTGGCTGG - Intronic
1002309726 5:178307041-178307063 GGGGGTCTGCTGGCTGTGGAGGG + Intronic
1002431666 5:179207687-179207709 GAGGCTGTCCAGGCTGTCCAGGG + Exonic
1002554505 5:180024924-180024946 AGGGGTCTCCATGCTGTCGCAGG + Intronic
1004129072 6:12901856-12901878 CAGGGATTCCAGGCTGTCTAAGG - Intronic
1004162381 6:13225979-13226001 GATGGCCTCCAGGGTGGCGAAGG - Intronic
1004347823 6:14864656-14864678 GAGGGTGGCCAGGTTGTTGACGG - Intergenic
1009631432 6:66206028-66206050 AAGGGTATCCAAGCTGTCAATGG - Intergenic
1015479209 6:133689686-133689708 GAGGGTCACCATGATGGCGAGGG + Intergenic
1016172720 6:141040229-141040251 GACGGTCTCCAGTCTGTTGCGGG - Intergenic
1017801014 6:157896845-157896867 GAGGCACTCCAGGCTGACCAGGG - Exonic
1018051357 6:160011696-160011718 GAGGGAATCCAGGCTGGGGAAGG - Intronic
1018372054 6:163177527-163177549 GAAAGGCTCCAGGCTGTGGAGGG + Intronic
1025610551 7:63072671-63072693 GAGGGGCTCCAGGGAGCCGAAGG - Intergenic
1025708955 7:63890585-63890607 GAGGGGCTCCAGGGAGTCGGAGG + Intergenic
1028676935 7:93475865-93475887 GAGAGTCTCCAGGCTGTTAGCGG - Intronic
1029457257 7:100677595-100677617 GCGGGTCTTGAGGCTGTAGATGG - Exonic
1032559008 7:132868879-132868901 GTGGGTCACCAGGCTGTGGTGGG - Intronic
1035099004 7:156381339-156381361 GAGGGTCTCCAGGCAGCTGTTGG - Intergenic
1035238842 7:157517253-157517275 GAGGGCCTCCAAGCTGGGGAGGG + Intergenic
1036922864 8:12874427-12874449 CAGGGAATCCAGGCTGTTGAGGG + Intergenic
1037581298 8:20247352-20247374 GGGGGTCTCCAGCCTGGGGAGGG + Exonic
1037749563 8:21672239-21672261 GAGGGTCTCGAGGCTGGGGCAGG + Intergenic
1039826279 8:41176567-41176589 CAGGGTCTCCAGCTTGTGGATGG - Intergenic
1039886174 8:41655183-41655205 GAGCGTCACCAGGGAGTCGAGGG + Intronic
1042651449 8:71046320-71046342 AAGGCTCTCAAGGCTGCCGAGGG + Intergenic
1042806381 8:72775173-72775195 GAAGGACTGCAGGCTGTGGAAGG - Intronic
1043150422 8:76707693-76707715 TAGGGCCTCCAGGCTGTCAGAGG - Exonic
1043510847 8:80948875-80948897 GAGGGTCTTGAGGCTGCTGATGG + Intergenic
1045489356 8:102656751-102656773 TAGGGTCTCCAGGCTCCCGCTGG + Intergenic
1049311725 8:141937152-141937174 GAGGGTATCCAGGTTGCAGAGGG + Intergenic
1049675153 8:143885959-143885981 GGGGGGCTCCAGGCTGGGGAGGG - Intergenic
1049989386 9:977237-977259 GAGGCTCTCCAAGCTCTCGTTGG - Exonic
1051813887 9:21081679-21081701 GAGGCTCTCATGGCTGTGGAGGG + Intergenic
1053287355 9:36858687-36858709 GAGGGTCTCCAAGCTGGAGGGGG - Intronic
1057380503 9:94563169-94563191 GTGAGTCTCCAGGCTGTGGGAGG - Intronic
1059443219 9:114322680-114322702 GAGGGTCCCCAGGCTGGCATGGG - Intergenic
1059444413 9:114329452-114329474 GAGGGTCCCCAGGCTGGCATGGG - Intergenic
1060199723 9:121645437-121645459 GAGGTGGTCCAGGCTCTCGACGG + Intronic
1061329450 9:129883244-129883266 GAGGGGCCCCAGGCTTTCCATGG - Intergenic
1061452948 9:130678434-130678456 CCGGGTCTCCTGGCTGTGGAGGG + Intronic
1186313725 X:8346633-8346655 CTGGGTCTCCAGGCTGCAGAAGG + Intergenic
1187272686 X:17793021-17793043 GATGCCCTCCAGGCTGTCCAGGG - Intergenic
1187310629 X:18137721-18137743 GAGGCTCTCCAAGCTTTCCAGGG - Intergenic
1190507097 X:51137083-51137105 CAGGGTCTCCAGCCTGCAGATGG - Intergenic
1192440002 X:71167322-71167344 GAGGGTCTCAAGTTTGTGGAAGG + Exonic