ID: 1148835931

View in Genome Browser
Species Human (GRCh38)
Location 17:50465761-50465783
Sequence AGGGTCTCCAGGCTGTCGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835915_1148835931 29 Left 1148835915 17:50465709-50465731 CCGAAGGCCCCGGAGCTGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 357
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
1148835917_1148835931 22 Left 1148835917 17:50465716-50465738 CCCCGGAGCTGGCAGGTACACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
1148835919_1148835931 20 Left 1148835919 17:50465718-50465740 CCGGAGCTGGCAGGTACACTTCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
1148835926_1148835931 -1 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117
1148835918_1148835931 21 Left 1148835918 17:50465717-50465739 CCCGGAGCTGGCAGGTACACTTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG 0: 1
1: 0
2: 2
3: 4
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835931 Original CRISPR AGGGTCTCCAGGCTGTCGAA GGG Exonic
901466580 1:9425587-9425609 AGGGTCTCCAGGCTCTGGAAGGG - Intergenic
901736344 1:11314692-11314714 AGGGAGTCCAGGCTGGCCAAAGG - Intergenic
906533908 1:46540828-46540850 GGGGTCTCCATGCTGGCAAAAGG + Intergenic
909111703 1:71486919-71486941 AGTGTCTCCAGGGTGTAGTATGG - Intronic
913044074 1:115058477-115058499 AAGGTCACAAGGCTGTTGAATGG + Intronic
914754602 1:150555516-150555538 AGGGGCTCCAGGCTGACACAGGG - Exonic
919157607 1:193787055-193787077 AGGTTCTTCAGGCTGGCCAAAGG + Intergenic
922215882 1:223519734-223519756 AGGGTCTCCCGGCTTTCTCATGG - Intergenic
922884937 1:229012217-229012239 AGGATGGCCAGGCTGTGGAAAGG - Intergenic
1072357330 10:94624394-94624416 TGGGTCTCCAGGCTTGAGAATGG - Intergenic
1076029710 10:127147223-127147245 ATGTTCTCCAGCCTGTCTAAGGG + Intronic
1084940504 11:72610222-72610244 TGGGTCCCCAGGCTGTCCATGGG - Intronic
1086035117 11:82405495-82405517 CTGGTTTCCAGGCTGTGGAAAGG - Intergenic
1091106099 11:132921138-132921160 GAGGGTTCCAGGCTGTCGAAAGG - Intronic
1096549729 12:52364221-52364243 AGGGTCACCATGCTGACCAAAGG - Intronic
1102602244 12:114040189-114040211 AGGGCTTCCAGGCTGGCCAAGGG - Intergenic
1108141516 13:47427406-47427428 ATGGTATCCAGGCTCTCGGAGGG + Intergenic
1110651601 13:77948610-77948632 AGCTTATCAAGGCTGTCGAATGG + Intergenic
1113578260 13:111409917-111409939 AGGGTCCCCAGGCTGATGACAGG + Intergenic
1114475745 14:22993408-22993430 AGGGTCTCCACTCTGTAAAAAGG + Intronic
1115894259 14:38066596-38066618 AAGGTGTCCAGACTGTGGAATGG - Intergenic
1119620795 14:76130655-76130677 AGGGTCTCTAGGCGGTGGAGTGG - Intergenic
1122171417 14:99878515-99878537 AGTGTCTCCTGGGGGTCGAAGGG + Exonic
1128410625 15:67393451-67393473 AGGGTCTCAAGGGAGTTGAAAGG - Intronic
1129086717 15:73101584-73101606 ATGGTCTACAGGCTGTAAAATGG + Intronic
1132273353 15:100545008-100545030 AGGGTCTACAGGCTGTTGATAGG + Intergenic
1135524672 16:23205368-23205390 TGGGTCTCTAGGCTGTCTCAGGG - Intronic
1136684076 16:31983920-31983942 AGGGTCTCCAGGCTGCAGTTTGG + Intergenic
1136784701 16:32927472-32927494 AGGGTCTCCAGGCTGCAGTTTGG + Intergenic
1136885082 16:33926334-33926356 AGGGTCTCCAGGCTGCAGTTTGG - Intergenic
1137393741 16:48102511-48102533 AGGGTGTCCAGGTTCTTGAAGGG - Intronic
1137488860 16:48914068-48914090 ACAGTCTTCAGGCTGTGGAAGGG + Intergenic
1142125160 16:88406510-88406532 AGGATCTCCAGGTTATCGGAAGG + Intergenic
1203087359 16_KI270728v1_random:1191478-1191500 AGGGTCTCCAGGCTGCAGTTTGG + Intergenic
1145005399 17:19334560-19334582 AGGGTCTCCAGGATGTTGCCTGG + Exonic
1147145001 17:38479614-38479636 AGGGTCTCCAGGCTGCAGTTAGG + Intronic
1147925469 17:43942911-43942933 AGAGCCTCCAGGCTGAAGAATGG + Intergenic
1148148859 17:45384331-45384353 CAGGGCTCCAGGCTGTGGAATGG + Intergenic
1148835931 17:50465761-50465783 AGGGTCTCCAGGCTGTCGAAGGG + Exonic
1149086554 17:52724379-52724401 AGGGTCTCCAGCTTGTAGAAGGG + Intergenic
1149659709 17:58327882-58327904 AGGGTCCCCAGGCCGTGGGAGGG + Exonic
1152277385 17:79366050-79366072 AGGGGCTCCAGGCTGCAGCATGG - Intronic
1152600032 17:81257688-81257710 AGGGTCTGCTGGGTGTCGACGGG - Intronic
1155566231 18:27137754-27137776 AGGGTCTCAAAGCTGTCTTACGG + Intronic
1155894896 18:31312648-31312670 TGTGGCTCCAGGCTGTGGAATGG - Intergenic
1160503316 18:79413116-79413138 ATGGTCTCCAGGCTTACGGACGG + Intronic
1160555059 18:79719367-79719389 AGCGTCGCCAGGCTGCCGCACGG - Intronic
1161643223 19:5436833-5436855 ATGGGCTCCAGGCTGGCCAATGG - Intergenic
1161709221 19:5838508-5838530 AGGGTCTGCAGGCTGTGCAGTGG - Intronic
1161715432 19:5873682-5873704 AGGGTCTGCAGGCTGTGCAGTGG - Intronic
1163475734 19:17525130-17525152 AGGGGCTCCAGGCTGGAGGAAGG - Intronic
1167630209 19:50621715-50621737 AGGGACTTCAGGCTGTTCAAGGG - Intronic
927054673 2:19357572-19357594 AGGGTCTCCGGGCTGGGGACAGG - Intronic
928220504 2:29399334-29399356 AGGGTCCCCTGGCTGTCCCAAGG - Intronic
930218959 2:48726212-48726234 AGGGGCACCAGTCTGTGGAATGG + Intronic
934896196 2:98122222-98122244 AGGGAGTCCAGGCTGGCCAAAGG - Intronic
936247329 2:110839788-110839810 AGGATCCCCAGGCTGTGGGAGGG - Intronic
937116548 2:119408903-119408925 GGAGTCTCCAGGCTGTCGCCAGG - Intergenic
937151939 2:119692075-119692097 AGGGTCTCCAGGCTTAGGAGAGG - Intergenic
939125416 2:138172241-138172263 CTGTTCTCCAGGCTGTGGAATGG + Intergenic
939635966 2:144582900-144582922 GGGGTCCCCAGGCGGTTGAATGG + Intergenic
946420036 2:219559554-219559576 AGGGACTTCATGCTGCCGAATGG - Intronic
1170668512 20:18407415-18407437 AGGGTTTCCAGGTATTCGAAGGG - Intronic
1171406670 20:24916298-24916320 AAGTTCTCCAGGCTACCGAAAGG + Intergenic
1174566101 20:51465541-51465563 AGGGTCTCCAGGGAGGAGAAAGG - Intronic
1175791986 20:61745670-61745692 AGGGTCCCCAGGCTGTCCAAGGG - Intronic
1175792098 20:61746218-61746240 AGGGTCCTCAGGCTGCCCAAGGG - Intronic
1181042208 22:20197475-20197497 GGGGTCTGCAGGCTGATGAATGG - Intergenic
1181582776 22:23837230-23837252 AGGGCCACCAGGCTGTGGATGGG - Intronic
1183367823 22:37416638-37416660 AGGGTCTCCGGTCTGTCCACAGG + Intronic
1183919641 22:41155073-41155095 AGGGTCCACAGGTTGACGAAAGG - Exonic
1184681549 22:46074842-46074864 AGGGTCTCCAGGGTGCTGATGGG + Intronic
1185052854 22:48562871-48562893 AGGGTCTCCGAGCTGTCAAGTGG - Intronic
950144183 3:10636012-10636034 GAGGTCTCCAGGCTGCCAAATGG - Intronic
950270992 3:11614779-11614801 AGGGTTGTCAGGCTCTCGAATGG - Intronic
953538734 3:43795724-43795746 AGGGTTTCCAGGTTGTCCCAGGG + Intergenic
954819369 3:53312269-53312291 AGCATCTCCAGGATGTCGATGGG + Exonic
959007183 3:101033427-101033449 AGGGTCTCCAGGTTGGGGAAAGG + Intergenic
961823740 3:129588141-129588163 AGGGGCTCCAGGCTGTGGCGGGG + Intronic
967887333 3:194342110-194342132 AGGGTCTGCAGGCTGGTGAGTGG + Exonic
969241523 4:5901778-5901800 AGGATCACCATGCTGTCTAAAGG + Intronic
970155470 4:13137262-13137284 AGGGTCTGCAGGTTGAGGAAGGG + Intergenic
970193196 4:13533957-13533979 AGGGTCTCCAGGCCCTCAGAGGG + Intergenic
976657982 4:87509623-87509645 TGGGTCTCTAGGCTGTCAATAGG + Intronic
982243517 4:153325167-153325189 AGGCTCTCCAGGATGCAGAAAGG - Intronic
983872560 4:172838769-172838791 AGGGTAAACAGGCTGTCGAGTGG - Intronic
983965576 4:173806001-173806023 ATGGTCTCCAGGCAGGCCAAAGG - Intergenic
984261229 4:177445194-177445216 AGGGGCTGCTGGATGTCGAAAGG + Intergenic
984745234 4:183209069-183209091 AGAGTCTGAAGGCTGTGGAAGGG + Intronic
993011495 5:82488444-82488466 AGGGTCTCCAGTCAGGAGAATGG + Intergenic
994515241 5:100763250-100763272 AGGTTTTCCAGGCTGTGTAAAGG - Intergenic
1002300635 5:178255659-178255681 AGGGTCTCCAGCCTGCACAAGGG - Intronic
1003047463 6:2746933-2746955 AGGGGCTCCAGGCCATGGAAAGG + Intronic
1003392131 6:5723410-5723432 AGGGTCTGCAGCGTGTCCAAGGG - Intronic
1003587126 6:7401501-7401523 GGGGTCTGCAGGCTCTTGAAAGG + Intronic
1003703666 6:8498825-8498847 AGGGTGGCCAGGCTGTCTGATGG - Intergenic
1004162380 6:13225978-13226000 ATGGCCTCCAGGGTGGCGAAGGG - Intronic
1008435661 6:51473183-51473205 AAGGAGTCCAGGCTGTGGAAAGG + Intergenic
1009932652 6:70194392-70194414 AGGGGCACCAGGATGTTGAAGGG - Intronic
1016898231 6:149074893-149074915 AGGTACTCCAGGCTGTGGATTGG - Exonic
1018051356 6:160011695-160011717 AGGGAATCCAGGCTGGGGAAGGG - Intronic
1023908447 7:44538014-44538036 AGGGTCTCCAGGACGCCTAAGGG - Intronic
1023962348 7:44937559-44937581 AGGGCCTCCAGGCTGAGCAAAGG + Intergenic
1025588969 7:62830945-62830967 AGTGTTTCCAGACTGTTGAAGGG - Intergenic
1025595486 7:62919145-62919167 AGTGTTTCCAGACTGTAGAATGG - Intergenic
1025610550 7:63072670-63072692 AGGGGCTCCAGGGAGCCGAAGGG - Intergenic
1026888504 7:73968515-73968537 AGGGTCTCCAGGCTGCTGAGAGG - Intergenic
1027267400 7:76501864-76501886 TGTGTCTCCAGCCTGTGGAATGG + Intronic
1027319213 7:77001729-77001751 TGTGTCTCCAGCCTGTGGAATGG + Intergenic
1028160982 7:87484170-87484192 AGGCTCTCCTGCCTGTGGAAAGG + Intergenic
1029410952 7:100410305-100410327 TGGGTCTCCAGGCTTCAGAAAGG - Intronic
1033313956 7:140282622-140282644 AGAGGCTCCAGGCTGACAAAGGG + Intergenic
1034447005 7:151118876-151118898 AGGGAATGCAGGCTGTGGAATGG - Intronic
1034948124 7:155277223-155277245 GGGGTCTCCAGGCTGTCTGCAGG + Intergenic
1036011118 8:4725859-4725881 AGGGTCTACAAGATGTCGGAGGG - Intronic
1051143506 9:14003295-14003317 CTGGTCTCCAGGCTGTCGTTAGG + Intergenic
1057522111 9:95768432-95768454 AGGGGCTCCAGACTTTCCAAGGG - Intergenic
1058199954 9:102027469-102027491 AGAGTGGCCAGGCTGTCAAAAGG - Intergenic
1061452949 9:130678435-130678457 CGGGTCTCCTGGCTGTGGAGGGG + Intronic
1062677465 9:137755377-137755399 TGAGTTGCCAGGCTGTCGAATGG + Intronic
1185792168 X:2935519-2935541 AGGGTCTGCAGGGTGTGAAATGG + Intronic
1186795582 X:13044225-13044247 TGGGCGTCCAGGCTGGCGAATGG - Intronic
1192440003 X:71167323-71167345 AGGGTCTCAAGTTTGTGGAAGGG + Exonic
1192929246 X:75787319-75787341 AGGGTTTCAATGCTGTGGAATGG - Intergenic