ID: 1148835932

View in Genome Browser
Species Human (GRCh38)
Location 17:50465762-50465784
Sequence GGGTCTCCAGGCTGTCGAAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835915_1148835932 30 Left 1148835915 17:50465709-50465731 CCGAAGGCCCCGGAGCTGGCAGG 0: 1
1: 0
2: 3
3: 39
4: 357
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1148835919_1148835932 21 Left 1148835919 17:50465718-50465740 CCGGAGCTGGCAGGTACACTTCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1148835926_1148835932 0 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1148835917_1148835932 23 Left 1148835917 17:50465716-50465738 CCCCGGAGCTGGCAGGTACACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147
1148835918_1148835932 22 Left 1148835918 17:50465717-50465739 CCCGGAGCTGGCAGGTACACTTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG 0: 1
1: 0
2: 0
3: 12
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835932 Original CRISPR GGGTCTCCAGGCTGTCGAAG GGG Exonic
900292247 1:1928474-1928496 GGGCCTCCAGGTTGTTGGAGGGG + Intronic
900421671 1:2558498-2558520 GGGCATCCAGGCTGCCCAAGCGG - Intronic
903139037 1:21327533-21327555 AGGTCTCCCGGTTCTCGAAGGGG - Intronic
903555949 1:24193489-24193511 GTCTCTCCAGGATGTTGAAGAGG - Intergenic
904597580 1:31656524-31656546 GGGGCCTCAGGCTGTGGAAGGGG - Intronic
905248462 1:36630737-36630759 GGCTCTCCAGGAAGTCGGAGAGG - Intergenic
905616629 1:39405476-39405498 GGGTCTCCAGATTGTCCCAGAGG + Intronic
907625688 1:56027020-56027042 GGTTCTGCAGGCTGTACAAGAGG - Intergenic
911962655 1:104326376-104326398 GGTTCTCCAGGCTGTACAGGAGG + Intergenic
913669482 1:121082509-121082531 GGGTCTCCAGGCTGTGGTACAGG - Intergenic
914021237 1:143869907-143869929 GGGTCTCCAGGCTGTGGTACAGG - Intergenic
914659729 1:149777831-149777853 GGGTCTCCAGGCTGTGGTACAGG - Intergenic
916192561 1:162193418-162193440 GGGTATGCAGGCTGTTGAAAAGG + Intronic
919143686 1:193606361-193606383 TGGTTTCCAGGCTGTGGAGGTGG + Intergenic
920348373 1:205321454-205321476 GGGTCTCCAGGAACTCGTAGCGG + Exonic
923534103 1:234835331-234835353 GGGTCCCCAGGGTGGCCAAGTGG + Intergenic
924832043 1:247606410-247606432 GGGTCACCATGGTGTAGAAGAGG - Exonic
1065689078 10:28315120-28315142 GGGTCTCCAGGCTGTCACCCAGG - Intronic
1070856509 10:79611570-79611592 GGGTCTCCAGGCTGCTGAGGAGG - Exonic
1072357329 10:94624393-94624415 GGGTCTCCAGGCTTGAGAATGGG - Intergenic
1072390633 10:94982396-94982418 GGCTCTGCAGGCTGTGCAAGAGG + Intronic
1073102137 10:101011967-101011989 GCATCACCATGCTGTCGAAGCGG + Intronic
1076029711 10:127147224-127147246 TGTTCTCCAGCCTGTCTAAGGGG + Intronic
1076075291 10:127529360-127529382 GGGCATCTAGGCTGGCGAAGGGG + Intergenic
1077143716 11:1035775-1035797 GGGGCTCCCGGCTGTGGAGGAGG + Intronic
1077609316 11:3634771-3634793 GGGTCTGCAGGCTGGAGAATAGG + Intergenic
1084940503 11:72610221-72610243 GGGTCCCCAGGCTGTCCATGGGG - Intronic
1085385358 11:76154547-76154569 GAGGGTCCAGGCTGTGGAAGGGG + Intergenic
1088057025 11:105596049-105596071 GGTTCTGCAGGCTGTACAAGAGG - Intergenic
1088912790 11:114204652-114204674 GGGGCTCCAGGCAGGAGAAGTGG + Intronic
1090065690 11:123501456-123501478 TGGGCTCCAGGCTGGCGCAGTGG - Intergenic
1091080829 11:132666194-132666216 GGCTCTGCAGGCTGTAGAGGAGG + Intronic
1091219252 11:133920568-133920590 GGGTCTCCAGCCCCCCGAAGGGG + Exonic
1091293581 11:134456624-134456646 CGGTCTCCAGGCTCAGGAAGGGG + Intergenic
1092866353 12:12765107-12765129 GGTTCTGCAGGCTGTATAAGAGG + Intronic
1098072194 12:66687813-66687835 GGGTATCAAGGCTGACTAAGTGG + Intronic
1101590518 12:106121429-106121451 GGGTCTCCTGTCTTTCTAAGTGG + Intronic
1111857066 13:93651700-93651722 GGGTCTCCAGGCTTTCTGGGTGG + Intronic
1113810918 13:113141855-113141877 GGGTCACCAGGCTCTTGAAAAGG - Intronic
1117725922 14:58673416-58673438 AGGTCTCTAGGCTGTCGAACTGG + Intergenic
1118793400 14:69116598-69116620 GGGGCTCCAGGCCGTTGGAGTGG - Intronic
1119905518 14:78298240-78298262 GGGGCTCCAGGCTGGGGGAGAGG + Intronic
1122933358 14:104944839-104944861 GGAGGTCCAGGCTGTCCAAGTGG - Exonic
1124493623 15:30173473-30173495 GGGCCTCCAGGCTGGGGAGGAGG - Intergenic
1124749945 15:32365176-32365198 GGGCCTCCAGGCTGGGGAGGAGG + Intergenic
1125720124 15:41841352-41841374 GGGTCCCCAGGCTGAGGCAGCGG - Intronic
1130727264 15:86452225-86452247 AGGTCTCCAGGCAGGCCAAGTGG + Intronic
1131558006 15:93415835-93415857 TGGCATCCAGGCTGTGGAAGGGG + Intergenic
1132565278 16:619638-619660 GGGGCTCCAGGCTCACGAACTGG - Intronic
1132864970 16:2088762-2088784 GGGTGTCGAGGCTCTAGAAGCGG + Exonic
1132977365 16:2717394-2717416 GGGTCTCCAAGCTGGGGTAGAGG - Intronic
1133230752 16:4365443-4365465 TGGACTCCAGGCTGTGGATGTGG + Intronic
1138588640 16:57987346-57987368 GGGTTTCCAGGGTGTCCTAGGGG - Intronic
1140128388 16:72136663-72136685 GGGGCTGCAGGCTGTGGCAGGGG - Intronic
1141846289 16:86611166-86611188 TGGACTCCAGCCTGTTGAAGGGG - Intergenic
1142194995 16:88735291-88735313 GGGTCCCCCGGCTGTGGGAGGGG - Intronic
1144727557 17:17509480-17509502 GGTTGTCCAGGATGTTGAAGGGG + Exonic
1148835932 17:50465762-50465784 GGGTCTCCAGGCTGTCGAAGGGG + Exonic
1151279885 17:73065513-73065535 GTGTGTCCAGGCTGTGGAATTGG - Intronic
1151886927 17:76928345-76928367 GGTGCTCCGGGCTGTGGAAGAGG + Intronic
1151971458 17:77459582-77459604 GGTTCTGCAGGCTGTACAAGTGG + Intronic
1152145635 17:78567076-78567098 GGGTCACCAGGCTCCCGAGGAGG + Exonic
1153216797 18:2828217-2828239 GGTTCTACAGGCTGTACAAGAGG + Intergenic
1155317690 18:24588958-24588980 AGTTCTCCAGGCTGTACAAGAGG - Intergenic
1155894895 18:31312647-31312669 GTGGCTCCAGGCTGTGGAATGGG - Intergenic
1159001528 18:62979207-62979229 TAGCCTCCAGGCTTTCGAAGAGG - Exonic
1160667910 19:341841-341863 GGGTCTTCAGGCAGTAGAAGCGG + Intronic
1161379866 19:3959211-3959233 GGTTCTCCAGGCGGCTGAAGCGG + Exonic
1163843846 19:19627959-19627981 GCGTCTCCAGACTGGGGAAGGGG + Exonic
1165436381 19:35797558-35797580 GGGGCTACAGGCTGGGGAAGGGG + Intergenic
1166052680 19:40269839-40269861 GGGGCTCCAGGCTGCAGGAGGGG - Intronic
1166963805 19:46515579-46515601 GGGTCTCCAGTATGGAGAAGGGG + Intronic
1167105996 19:47430112-47430134 ACGCCTCCAGGCTGGCGAAGAGG + Exonic
925839625 2:7979493-7979515 GGTTCCCCAGGCTCTAGAAGAGG + Intergenic
925907976 2:8550860-8550882 GGGTCACCAGGCAGTCCTAGAGG + Intergenic
927198479 2:20564172-20564194 GGGTTTCCAGCCTGAGGAAGAGG - Intronic
937039659 2:118811061-118811083 GGGTCCCCAGGCCTTCTAAGTGG + Intergenic
938291744 2:130154324-130154346 GGCCCTCCAGGCTGTAGACGTGG + Exonic
938464806 2:131518639-131518661 GGCCCTCCAGGCTGTAGACGTGG - Intergenic
939232482 2:139447651-139447673 GAGTCTCTAGGCTGCCGAGGAGG - Intergenic
944908507 2:204286355-204286377 GGGTCTCAGGGCTGTCTCAGGGG - Intergenic
948696679 2:239736399-239736421 GGGACTCCAGGCTCTCCCAGTGG - Intergenic
1171448848 20:25222489-25222511 GGGACTCCGGGCTGGCGGAGGGG + Intronic
1173660080 20:44727214-44727236 GGGTCTCCAGTCGGCAGAAGCGG - Exonic
1175831787 20:61968621-61968643 GAGCCTCCTGGCTGGCGAAGGGG - Intronic
1176309589 21:5142585-5142607 GGGCCACCATGCTGTTGAAGTGG + Exonic
1176457993 21:6929442-6929464 GGGTGTCCAGGCTGTCTCTGTGG - Intergenic
1176836165 21:13794526-13794548 GGGTGTCCAGGCTGTCTCTGTGG - Intergenic
1177725623 21:24963283-24963305 GGTTCTGCAGGCTGTCCAGGAGG - Intergenic
1178555673 21:33588386-33588408 GGTTGTCCAGGCGGGCGAAGGGG + Exonic
1179847471 21:44119448-44119470 GGGCCACCATGCTGTTGAAGTGG - Exonic
1181187521 22:21117767-21117789 TGGTGTCCAGGATGTCGAGGGGG + Intergenic
1181211677 22:21292726-21292748 TGGTGTCCAGGATGTCGAGGGGG - Intergenic
1181582775 22:23837229-23837251 GGGCCACCAGGCTGTGGATGGGG - Intronic
1181851806 22:25754893-25754915 GGGAATCCTGGCTGTCGTAGGGG - Intronic
1182432880 22:30310943-30310965 GGGTCTCCAGGATGGAGAGGAGG + Intronic
1182676350 22:32042630-32042652 GGGGCTGCAGGCTGTGGAGGGGG + Intergenic
1182740449 22:32563648-32563670 AGGGCTCCAGGTTGTCCAAGGGG - Intronic
1184681550 22:46074843-46074865 GGGTCTCCAGGGTGCTGATGGGG + Intronic
1184944887 22:47795998-47796020 GGGTCTCCAGGCTGCAGCTGTGG - Intergenic
1203215276 22_KI270731v1_random:2706-2728 TGGTGTCCAGGATGTCGAGGGGG + Intergenic
950095672 3:10328822-10328844 ACGTCTCCAGGCTGTGGATGGGG + Exonic
951967010 3:28398611-28398633 GGGTGTCCAAACTGTGGAAGTGG + Intronic
952833813 3:37587805-37587827 GGGTCACCAGGCAGTCAAGGCGG + Intronic
953932688 3:47013548-47013570 GGGTCCCTAGGCTGTGGGAGGGG + Intergenic
954803991 3:53204708-53204730 GGGTCTCCAGGCTGTGGGACAGG + Intergenic
955380377 3:58433664-58433686 AGGTCTCCGGGCTGCTGAAGAGG - Exonic
956208264 3:66776472-66776494 GGTTCTTCAGGCTGTCGCAGTGG - Intergenic
956284146 3:67590673-67590695 GGTTCTGCAGGCTGTACAAGAGG - Intronic
957910132 3:86609338-86609360 GGTTCTTCAGGCTGTACAAGAGG + Intergenic
958455490 3:94326034-94326056 GGGTCACCATGTTGTCCAAGTGG + Intergenic
958528976 3:95299741-95299763 GGTTCCACAGGCTGTCCAAGAGG - Intergenic
961831188 3:129623748-129623770 GGGGCTCCGGGCTGGCGAGGCGG + Intergenic
969217081 4:5731235-5731257 GGGCCTCTGGGCTGTCGATGTGG + Intronic
970193197 4:13533958-13533980 GGGTCTCCAGGCCCTCAGAGGGG + Intergenic
971895912 4:32593661-32593683 GGTTCTGCAGGCTGTATAAGAGG - Intergenic
976657983 4:87509624-87509646 GGGTCTCTAGGCTGTCAATAGGG + Intronic
977293208 4:95185324-95185346 GGGTCTCGAGGCTGCAAAAGTGG - Intronic
984276850 4:177621253-177621275 GGTTCTGCAGGCTGTGCAAGAGG - Intergenic
984745235 4:183209070-183209092 GAGTCTGAAGGCTGTGGAAGGGG + Intronic
987090411 5:14504543-14504565 GGGTCTCAAAGGTGTCGAGGAGG - Exonic
988710359 5:33768155-33768177 AGGTCTCCATGCTATGGAAGAGG + Intronic
997285445 5:132674970-132674992 AGGTGGCCAGGCTGTGGAAGAGG - Intronic
997580512 5:135013916-135013938 GGTTCTGCAGGCTGTCCAGGAGG + Intergenic
1001425475 5:171619454-171619476 GGGTCTCCAGGGTGGCGTCGTGG - Intergenic
1002079111 5:176727269-176727291 GGGTCTCCAGGCTGGCCATGTGG + Intergenic
1002309728 5:178307043-178307065 GGGTCTGCTGGCTGTGGAGGGGG + Intronic
1002403295 5:179006638-179006660 GGGGCTCCAGACTGCCAAAGTGG - Intergenic
1002639489 5:180623964-180623986 AGGTGTCCAGGCTCTCGATGGGG + Exonic
1003587127 6:7401502-7401524 GGGTCTGCAGGCTCTTGAAAGGG + Intronic
1004507412 6:16258347-16258369 GGCTCTCTAGGCTGTCCAACAGG - Intronic
1006212192 6:32405350-32405372 GGGTGTCCAGCCTGTCAAAATGG + Intronic
1006935197 6:37712331-37712353 GGGTCTCCAGTCTATAGAGGAGG + Intergenic
1013318199 6:108961202-108961224 GGGTCTTCAGGCTCTCCCAGGGG - Intronic
1018051355 6:160011694-160011716 GGGAATCCAGGCTGGGGAAGGGG - Intronic
1019358163 7:591726-591748 GCGTCTCCAGGCTGGAGAAGTGG - Intronic
1023020406 7:36006991-36007013 GCGTCTCAAGGCTTTGGAAGAGG - Intergenic
1024161669 7:46682362-46682384 GTGTCTCCATGCTGTGCAAGAGG - Intronic
1031041196 7:116840014-116840036 GTGTCTTCACGCTGTGGAAGGGG - Intronic
1032975208 7:137215116-137215138 GGTTCTCCAGACTGCCAAAGCGG + Intergenic
1033542046 7:142366154-142366176 GGTTCTGCAGGCTGTACAAGAGG + Intergenic
1037581300 8:20247354-20247376 GGGTCTCCAGCCTGGGGAGGGGG + Exonic
1045079427 8:98608662-98608684 GTGTCTCCATTCTGTCCAAGAGG + Intronic
1048217389 8:132508923-132508945 GGTTCTGCAGGCTGTACAAGAGG + Intergenic
1049643526 8:143726157-143726179 GGGTCCCCAAGCTGTCCGAGCGG + Exonic
1049646783 8:143739167-143739189 GGGTCTCCAGGCTGGAGGTGGGG + Intergenic
1049696159 8:143985245-143985267 CGGGCTCCAGGATGTCGTAGTGG + Exonic
1052784505 9:32816004-32816026 TGGGCTCCAGGCTGTGGCAGAGG + Intergenic
1055139453 9:72859488-72859510 GGATCTGCAGGCTGTACAAGAGG + Intergenic
1060416985 9:123437696-123437718 GGGTTTCCAAGCTGGTGAAGTGG + Intronic
1061180394 9:129022138-129022160 TGGGCTCAAGGCTGTTGAAGAGG - Intronic
1061204872 9:129157054-129157076 GGGCCTCCAGCTTGTCCAAGTGG + Intergenic
1061930806 9:133832192-133832214 GGGTCTCTGGGCTGCCCAAGGGG - Intronic
1062050731 9:134445298-134445320 GGTTCTGCAGGCTGTCCAGGAGG - Intergenic
1062515007 9:136928645-136928667 CGGGCTCCAGGCTGCAGAAGGGG + Intronic
1186795581 X:13044224-13044246 GGGCGTCCAGGCTGGCGAATGGG - Intronic
1189449100 X:41110542-41110564 AGGACTACAGGCTGTCAAAGTGG - Intronic
1190215732 X:48478388-48478410 GGGTCTCCAGGTTGGAGAAGTGG + Intronic
1192440004 X:71167324-71167346 GGGTCTCAAGTTTGTGGAAGGGG + Exonic
1198073834 X:133176086-133176108 TGGTCTCATGGCTGTCTAAGAGG - Intergenic