ID: 1148835934

View in Genome Browser
Species Human (GRCh38)
Location 17:50465769-50465791
Sequence CAGGCTGTCGAAGGGGAAGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835919_1148835934 28 Left 1148835919 17:50465718-50465740 CCGGAGCTGGCAGGTACACTTCC 0: 1
1: 0
2: 0
3: 10
4: 143
Right 1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1148835918_1148835934 29 Left 1148835918 17:50465717-50465739 CCCGGAGCTGGCAGGTACACTTC 0: 1
1: 0
2: 1
3: 11
4: 140
Right 1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1148835926_1148835934 7 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG 0: 1
1: 0
2: 2
3: 14
4: 170
1148835917_1148835934 30 Left 1148835917 17:50465716-50465738 CCCCGGAGCTGGCAGGTACACTT 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG 0: 1
1: 0
2: 2
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835934 Original CRISPR CAGGCTGTCGAAGGGGAAGT TGG Exonic
900484002 1:2912880-2912902 CAGGGATCCGAAGGGGAAGTTGG - Intergenic
900850048 1:5135666-5135688 GAGGGTGGTGAAGGGGAAGTGGG - Intergenic
901319287 1:8329928-8329950 CAGGAAGTGGAAGGGGATGTAGG + Intronic
901361399 1:8703586-8703608 CCGGCTGTCGGAGGGGAGGGAGG - Intronic
902571302 1:17348511-17348533 CAGGCTGTCCATGTGGAGGTGGG + Intronic
903760307 1:25693276-25693298 CAGGCTGAGGAGGAGGAAGTGGG + Intronic
905926227 1:41751847-41751869 CAGGCTGCCGATGAGCAAGTGGG + Intronic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
908574176 1:65441665-65441687 CAGAATGACGAAGGGGAAGTGGG + Intronic
910480170 1:87650028-87650050 TAGGCTGTTGAAGGGGAGGAGGG + Intergenic
911102077 1:94103166-94103188 CAGGGTGTTGAAGGGGAAATGGG + Intronic
911951969 1:104184732-104184754 CAGCCTGTGGGAGGGGGAGTGGG + Intergenic
915561829 1:156692326-156692348 GAGGCTCAGGAAGGGGAAGTGGG + Intergenic
920232245 1:204478330-204478352 CGGGCTGTGGGAGGGGCAGTTGG - Intronic
920247433 1:204599098-204599120 CAGGCTATGGAAGGCGAAGGTGG + Intergenic
922484429 1:225962388-225962410 CAGGCTGTAGCGGGGGAAGGAGG + Intergenic
922744293 1:228035647-228035669 CAGGCTCTCCAGGGGCAAGTGGG + Intronic
1063426131 10:5951443-5951465 CTGGCTGTACAAGGGGCAGTTGG + Intronic
1063603563 10:7503756-7503778 CAGGCTGTGGAAGAGTAAGAAGG - Intergenic
1067271244 10:44793048-44793070 CTGGCTGTCCAGGGAGAAGTGGG - Intergenic
1067478686 10:46581962-46581984 CAGGCAGCCGTCGGGGAAGTCGG - Exonic
1067616052 10:47759839-47759861 CAGGCAGCCGTCGGGGAAGTCGG + Intergenic
1069321059 10:67172137-67172159 CTGGCTTTTGAAGGAGAAGTAGG - Intronic
1069851584 10:71408856-71408878 CAGGCAGTTGAAAGGAAAGTAGG - Intronic
1070167057 10:73906853-73906875 CAGGCTGTGGAAGGGGTGGAGGG - Intergenic
1071007106 10:80895434-80895456 CAGTCTGTGGAACGGGAGGTAGG - Intergenic
1071528850 10:86374050-86374072 CAGGCAGTGGAAGGAGAAGGAGG + Intergenic
1073489677 10:103844662-103844684 CAGGCTGGGGAAGGGGAGGGAGG + Intronic
1074906116 10:117865369-117865391 CAGGCAGGCAAAGGGGAGGTTGG + Intergenic
1075715556 10:124553236-124553258 CAGCCTGACAAAGGGGAACTTGG + Intronic
1075737333 10:124672111-124672133 CATGCTGCCAAAGGCGAAGTGGG + Intronic
1076214564 10:128682681-128682703 CAGGCTGCCAGAGGGGAAGATGG - Intergenic
1077910554 11:6568597-6568619 CAGGCTCTCAAATTGGAAGTGGG + Intronic
1078445472 11:11401531-11401553 CAGGATGTCAAAGGGGTACTTGG - Intronic
1081811102 11:45914505-45914527 CAGGCTGGGGCAGGGGAAGGTGG + Intronic
1081999216 11:47383933-47383955 TAGTCTGTGGAAGGGGAACTGGG - Intergenic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084374150 11:68764475-68764497 CAGCCTGGGGAAGGGGAAGCCGG + Intronic
1091596436 12:1882058-1882080 CAGGCTGTGGAAGGGGAAGGGGG - Intronic
1096463356 12:51834972-51834994 CAAGCTGTAAGAGGGGAAGTGGG + Intergenic
1096477976 12:51920299-51920321 TAGGCTGTGGATGGGGATGTGGG + Intronic
1096750913 12:53758291-53758313 CAACCAGTAGAAGGGGAAGTGGG - Intergenic
1100301997 12:93316182-93316204 GAGGCTGTTCAAGAGGAAGTGGG - Intergenic
1101165544 12:102027679-102027701 CAGGCTGTGAAAGGGGATGTGGG - Intronic
1101587623 12:106098769-106098791 TAGGCTTTCAAAGGGGAAGTGGG + Intronic
1102962426 12:117101250-117101272 CAGGCAGTGGAAGAGGAAGCTGG - Intergenic
1104548345 12:129732607-129732629 CACCTTGTGGAAGGGGAAGTGGG - Intronic
1106653206 13:31714623-31714645 AAGACTGTGGAAGGGGAAATGGG + Intergenic
1108910309 13:55541947-55541969 AAGGCTGTCAATGAGGAAGTGGG - Intergenic
1110090773 13:71444939-71444961 GAGGCAGCAGAAGGGGAAGTAGG - Intronic
1113019615 13:105869959-105869981 TAGGTTGTCGAAGGGGTAGAAGG + Intergenic
1113411593 13:110095000-110095022 CAGGTTGCTGAAGGGGAAGCAGG - Intergenic
1113899714 13:113789493-113789515 CAGGCAGTCCAGGGGGATGTGGG + Intronic
1119598498 14:75958327-75958349 CAGGGTCTTGGAGGGGAAGTGGG + Exonic
1121798382 14:96754116-96754138 CAGGGTGTGGAAGGGGGAGAGGG + Intergenic
1121827957 14:97026258-97026280 CAGGCTTACCAAAGGGAAGTGGG + Intergenic
1122267111 14:100551858-100551880 CATGGTGGGGAAGGGGAAGTGGG + Intronic
1124018346 15:25897714-25897736 CAAGCTGTAGAAAGGAAAGTAGG - Intergenic
1125524715 15:40367725-40367747 CAGATTGACGAAGGGGAAGTAGG - Exonic
1128236786 15:66073145-66073167 CAGGCTGGCGAGGCGGAGGTGGG - Intronic
1129336829 15:74857212-74857234 CAGTCTGTCGCAGAGGAGGTTGG - Intronic
1130011050 15:80153083-80153105 CAGGTTGTGGATGGGGAAGTCGG - Exonic
1136367027 16:29813616-29813638 CAGGCTGGTGATGGGGAAGAGGG + Exonic
1137546514 16:49408191-49408213 CAGCCTATCCAAGGGGAAGCCGG + Intergenic
1138624141 16:58236031-58236053 CAGGCTTTGTAAGGGGAGGTGGG - Intronic
1141388725 16:83646780-83646802 CAGGCTGTAGGATGGGAATTTGG - Intronic
1143167046 17:4901952-4901974 CTGCCAATCGAAGGGGAAGTAGG + Exonic
1143521649 17:7447507-7447529 CTGCCAGTCGAAGGGGAAGTAGG - Exonic
1144727559 17:17509487-17509509 CAGGATGTTGAAGGGGAACACGG + Exonic
1145929510 17:28675075-28675097 CAGGATGGGGAAGGGGAAGAAGG + Exonic
1147190459 17:38735338-38735360 CTGGCTGTCGAAGGGGGAGTGGG + Exonic
1148344794 17:46895927-46895949 CAGGGTCTTGAAGGGGAAGCTGG + Intergenic
1148835934 17:50465769-50465791 CAGGCTGTCGAAGGGGAAGTTGG + Exonic
1149686462 17:58538401-58538423 CAGGCTGTCATAGGGCAAGGTGG - Intronic
1150634529 17:66903703-66903725 CAGGCTGCAGAATGGGAAGCTGG + Intergenic
1151875704 17:76867189-76867211 CAGGCTGGCTAAGGAGATGTTGG - Intergenic
1153159264 18:2184478-2184500 CAGGCTGTCCCAGAGGAACTGGG + Intergenic
1153535247 18:6095324-6095346 CAGGCTGAAGAAGGGGAACATGG + Intronic
1153623105 18:6998471-6998493 CAGGCTGTGGAAGGGAATGCTGG - Intronic
1155096437 18:22560105-22560127 CAGGGAGTGGAAGGGGAGGTTGG + Intergenic
1155275901 18:24187224-24187246 CGGGCTGATGAAGGGGAAGTAGG + Intronic
1155640693 18:28010572-28010594 CAGGCTATGGAAGGGGACGAAGG + Intronic
1156973478 18:43186978-43187000 CATGCTGGAGAATGGGAAGTAGG - Intergenic
1160155250 18:76429027-76429049 CAGGCTGACCCCGGGGAAGTTGG + Intronic
1160889494 19:1369719-1369741 GAAGCTGTGGAAGGGGACGTTGG + Intronic
1163171976 19:15537595-15537617 CAGGATGTCAAAGTGGAAGGCGG - Exonic
1163661349 19:18579640-18579662 CAGGCTGTAGGAGGGGAATTTGG + Intronic
1165409296 19:35648959-35648981 CAGTCTTTCGGTGGGGAAGTGGG - Intronic
1165771408 19:38382586-38382608 CAGGCTATGGAAGGTGAAATTGG + Intronic
1167696903 19:51020090-51020112 CAGACTGTGGAAGAGGAAGGAGG + Intronic
1168255016 19:55160366-55160388 GAGGCTGTCCAAGGGGGAGCTGG + Intronic
927892386 2:26759875-26759897 GAGGCTGTCTTAGGGCAAGTAGG + Intergenic
929621831 2:43362974-43362996 CAGGATGTGGAAGTGGAAGATGG - Intronic
929890969 2:45918263-45918285 CTGGCTGTGGAAGGGGCAGGTGG + Intronic
932144899 2:69308018-69308040 CTGGCTGTCAGAGGGGAAGGGGG - Intergenic
940681141 2:156786795-156786817 CTGGCAGTCGAAAGAGAAGTTGG + Intergenic
940797440 2:158095423-158095445 CTGGGTGTTGAAGGTGAAGTAGG - Intronic
943629222 2:190232359-190232381 CAGACTGCCAAAAGGGAAGTAGG - Intronic
945613558 2:212037219-212037241 CAAAGTGTAGAAGGGGAAGTTGG + Intronic
946919696 2:224566069-224566091 CAGCCTGTAGATGGGGAAGGTGG - Intronic
947750297 2:232528614-232528636 CTGCCAGTCGAAGGGGAAATAGG - Exonic
947752793 2:232541487-232541509 CTGCCAGTCGAAGGGGAAGTAGG - Exonic
948490781 2:238311451-238311473 CAGGCTGTGGAAGCAGAAATAGG + Intergenic
948662003 2:239513353-239513375 CAGGCAGGCGAAGGGGGAGCAGG - Intergenic
948766849 2:240226868-240226890 CAGCCTGTCCAAGGGGACCTGGG + Intergenic
1169394919 20:5220590-5220612 GAGACTGTGGAAGGGGAAGTGGG - Intergenic
1171768911 20:29306755-29306777 CAAGCTGTCTCTGGGGAAGTGGG + Intergenic
1174185073 20:48700779-48700801 AAGGTTGTCGAAGAGGAAGAAGG + Exonic
1174342699 20:49907813-49907835 CTGGCTGTGGTATGGGAAGTAGG - Intronic
1174575660 20:51535343-51535365 CAGGCTGTGCGAGGGGATGTGGG - Intronic
1175081902 20:56427782-56427804 CTGGCCCTCAAAGGGGAAGTAGG + Intronic
1175642483 20:60642670-60642692 CAGGCTGACCAAGGGGCTGTGGG - Intergenic
1179312138 21:40206018-40206040 CAGGCTCTCTAAGAGGAAGCAGG - Intronic
1179455428 21:41496589-41496611 TAGGCTGAGGAAGGGGAGGTGGG - Intronic
1179902595 21:44401773-44401795 CAGGCAGAGGAAGGCGAAGTAGG - Exonic
1180258742 21:46651548-46651570 CAGGCAGTGGAGGGGGAAGGCGG + Intronic
953136705 3:40188113-40188135 CAGGCAGTGGAAGTGGAACTGGG + Intronic
953888597 3:46734180-46734202 CAGGGTGGTGAAGGGGAAGCTGG - Exonic
955552203 3:60096834-60096856 CAGGCTGGGGAAGGGGCAGGAGG + Intronic
955808184 3:62758472-62758494 CAGTCTGACAAAGAGGAAGTGGG + Intronic
957927415 3:86832595-86832617 CAGGCTGTGGATGGGGAGCTAGG - Intergenic
962629088 3:137257990-137258012 GAAGCTGTCGACAGGGAAGTGGG - Intergenic
964626159 3:158762058-158762080 CAGGATGGGGAAGGTGAAGTGGG + Intronic
967647117 3:191938960-191938982 CAGGCTGTAGAACAGGAAGGGGG - Intergenic
967975882 3:195034656-195034678 CAGGCTTTGGAAGGGGAACCGGG + Intergenic
969280395 4:6166915-6166937 CAGGGTGGAGGAGGGGAAGTTGG - Intronic
970452025 4:16178587-16178609 CAGGCTAATTAAGGGGAAGTGGG - Intronic
972422840 4:38905796-38905818 GAGGCTGATGAAGGGGAAGTGGG - Exonic
972575658 4:40348995-40349017 CTGGTTGTCAAAAGGGAAGTAGG - Exonic
973631497 4:52824867-52824889 AAGGCTGTAGAAGGTGAAGCTGG + Intergenic
973636767 4:52868327-52868349 CAGCCTGTCTAAGGTGCAGTAGG - Intergenic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
979213548 4:118135255-118135277 CAGGCTTAGGAAGGGGTAGTGGG + Intronic
980537360 4:134145561-134145583 GAGGCTGTTGAAGGGTAAATGGG + Intergenic
985837698 5:2282550-2282572 CAGGCAGGCGAAGGGCAGGTGGG + Intergenic
988216502 5:28281273-28281295 CAGGCTGGCGAAGGAGATGGAGG - Intergenic
989344061 5:40409457-40409479 CAGGCTGTACAAGAGGCAGTGGG + Intergenic
990188313 5:53231121-53231143 CAAGCTGTAGGAGGGGAATTTGG - Intergenic
992837546 5:80655080-80655102 CGGGCTGAAGAAGGGGAAGGTGG + Intronic
997043543 5:130286324-130286346 CAGGATGTTGAGGGGGAGGTTGG + Intergenic
998031292 5:138870830-138870852 CAGCCTGTCTGTGGGGAAGTAGG + Exonic
999394073 5:151215417-151215439 CATGCTGTGGATGGGGAAGAAGG + Intronic
999779373 5:154836601-154836623 CAGGGTGTCAGAGGGGATGTTGG + Intronic
1007415578 6:41689433-41689455 CAGGTTGGCGAAGGGGCAGAGGG - Intronic
1011651068 6:89506679-89506701 CAAACTGTGGAATGGGAAGTGGG - Intronic
1011963116 6:93116489-93116511 CAGGCTGCCTAAGCGGAAATAGG - Intergenic
1012976358 6:105784765-105784787 CAGGCTGCCCATGGGGATGTAGG + Intergenic
1017649785 6:156570387-156570409 CAGGAGAGCGAAGGGGAAGTGGG + Intergenic
1018831398 6:167446427-167446449 CAGGGTGTCCTAGGGGCAGTGGG - Intergenic
1019184096 6:170210885-170210907 CAGGCTGGTGAAGGTGAAGATGG + Intergenic
1020981022 7:15069442-15069464 CAAGCTGTCTAAGAGGAAGCAGG - Intergenic
1021041151 7:15863967-15863989 CATGCTGTTGAAAGTGAAGTTGG + Intergenic
1022443601 7:30452559-30452581 CAGGCCATCGAAGGTGAAGAGGG + Exonic
1023522813 7:41065841-41065863 CAGGCTGTGGGTGGGGAAGGCGG + Intergenic
1024543931 7:50501350-50501372 TAGGTTGCCGATGGGGAAGTGGG - Intronic
1026444050 7:70468713-70468735 CAGGCTGGTGAAGAGGAAGCAGG + Intronic
1028245928 7:88477214-88477236 AAGGCTGTCGATGAGAAAGTCGG + Intergenic
1028456488 7:91043654-91043676 CTGGATGACGAAGGGGAAGGAGG - Intronic
1029040213 7:97565402-97565424 CAGGCTACGTAAGGGGAAGTTGG - Intergenic
1032840360 7:135708357-135708379 GAGGCTGGCGAAGGGGAGGCAGG + Intronic
1036789550 8:11708851-11708873 CGGGCTGTCGAAGGGGCCGGCGG - Exonic
1043485181 8:80692162-80692184 CAGGCAGTAGGAGGTGAAGTTGG - Intronic
1048840131 8:138558323-138558345 CAAGCTATGGAAGGAGAAGTGGG - Intergenic
1049275059 8:141716168-141716190 CAGGCGGTCGGAGGCGATGTGGG + Intergenic
1049356552 8:142192022-142192044 CAGGGTTTTGAAGGGTAAGTAGG + Intergenic
1049428590 8:142548998-142549020 CAGGATGGAGAAGGGGAAGAGGG - Intergenic
1049499875 8:142956059-142956081 CAGGCTGTGGGAGGGGCAGCAGG + Intergenic
1052324780 9:27205926-27205948 CAGGCTGTCGCTGGAGAAGAAGG + Intronic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1057361264 9:94375283-94375305 CAGACCGTCGACGGGGAAGTTGG + Intronic
1057662101 9:97012886-97012908 CAGACCGTCGACGGGGAAGTTGG - Intronic
1059458450 9:114414508-114414530 CAAGCTATCAAAGGGGAACTTGG - Intronic
1060767589 9:126306697-126306719 CAGGCTGAGGAAGGGGCTGTGGG + Intergenic
1060839707 9:126783854-126783876 AAGGGTGTGGAAGGGGAAGGTGG - Intergenic
1061883686 9:133580227-133580249 CAGGCTGTTGATGGAGAAGGGGG - Exonic
1062010308 9:134263543-134263565 GAGGCTGTGGAAGGGGCCGTGGG - Intergenic
1062028630 9:134352091-134352113 GAGGCTGTCGAAGGCAGAGTCGG + Intronic
1062107440 9:134763690-134763712 CAGGGTGACGACGGAGAAGTTGG + Exonic
1203770094 EBV:45498-45520 CAGGATGTCCCAGGGGACGTCGG - Intergenic
1186865040 X:13711873-13711895 CAGGCTGGTGAAGGTGAGGTAGG - Intergenic
1188583843 X:31749061-31749083 CTGGCTGTCTTTGGGGAAGTTGG - Intronic
1190972723 X:55367403-55367425 GAAGCTGTGGAAGGGGAGGTAGG + Intergenic
1194754988 X:97728371-97728393 CAGGCTCTATAAGGTGAAGTGGG - Intergenic
1195393068 X:104383358-104383380 CAGGCTCTGGCAGGGGAAGCAGG + Intergenic
1197067561 X:122251977-122251999 CAGGCTGGCCAAGTGGAACTAGG + Intergenic
1199362236 X:146935445-146935467 CAGGGTGTTGGAGGGCAAGTGGG - Intergenic
1201075644 Y:10185304-10185326 CAAGCTGTCTCTGGGGAAGTGGG - Intergenic