ID: 1148835935

View in Genome Browser
Species Human (GRCh38)
Location 17:50465772-50465794
Sequence GCTGTCGAAGGGGAAGTTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 150}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835926_1148835935 10 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835935 17:50465772-50465794 GCTGTCGAAGGGGAAGTTGGAGG 0: 1
1: 0
2: 0
3: 13
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835935 Original CRISPR GCTGTCGAAGGGGAAGTTGG AGG Exonic
900520628 1:3103914-3103936 CCTGTGGATGGGGAAGTTTGTGG - Intronic
900980697 1:6044571-6044593 GCTGTAGAGGTGGATGTTGGTGG + Intronic
901336131 1:8450838-8450860 GCTGTCGAAAGGTAGGATGGAGG - Intronic
902785131 1:18728176-18728198 GCTGACGAAGGCGGAGTTGTGGG + Intronic
903557144 1:24202342-24202364 GCTGGCTTTGGGGAAGTTGGCGG - Intergenic
903868165 1:26412960-26412982 GCTGTCTAATGGGGGGTTGGGGG - Intronic
904677133 1:32205494-32205516 GCTGTGGGAGGGGCAGTCGGGGG + Intergenic
906136834 1:43505994-43506016 GCTGTGGATGGGGAACTTGGGGG - Intergenic
906146742 1:43565049-43565071 GCTGTTGTGGGGGAAGGTGGTGG - Intronic
907087547 1:51690397-51690419 ATTGTCGAAGTGGAAGTTGTGGG + Intronic
907544101 1:55244308-55244330 GCTGTTTAAGTTGAAGTTGGGGG + Intergenic
908678533 1:66632963-66632985 GCTGGGGAAGGGGAGGATGGTGG + Intronic
910833711 1:91486269-91486291 GTTGTCCTAGTGGAAGTTGGAGG + Intergenic
911555082 1:99333692-99333714 GCTGTAGAAGGGGTAGATGTGGG + Intergenic
912389945 1:109296105-109296127 GCTGTAGAAGAGGCAGATGGCGG + Intronic
914825676 1:151136784-151136806 GCTGTGAAAGGGGAGTTTGGAGG + Intronic
915561832 1:156692329-156692351 GCTCAGGAAGGGGAAGTGGGGGG + Intergenic
915821059 1:159024271-159024293 ACTGAAGAAGGGGAAGATGGGGG + Intronic
917485688 1:175452591-175452613 GCTGTAGCCTGGGAAGTTGGGGG + Intronic
919745984 1:201009454-201009476 GCTGTCGAAGGAGAAGATTGAGG - Exonic
920540385 1:206773755-206773777 CCTGTGGAAGGGGAAGGTGAAGG - Intergenic
922982541 1:229839853-229839875 GCTGTTGAAGGGGAAGGGGCTGG + Intergenic
923433706 1:233949014-233949036 GCTCTGGAATGGGAGGTTGGGGG - Intronic
924039388 1:239969135-239969157 GCTGAGGAATGGGAAATTGGGGG + Intergenic
1063426132 10:5951446-5951468 GCTGTACAAGGGGCAGTTGGTGG + Intronic
1067282137 10:44880741-44880763 GCTGTTGATGGGGGAGATGGTGG + Intergenic
1072151821 10:92690144-92690166 GCTGGTGAAGGAGGAGTTGGGGG - Exonic
1075847603 10:125557541-125557563 GATGTTGAAGGGAAACTTGGAGG - Intergenic
1077495811 11:2886027-2886049 GCTGTAGCAGGGGAAGGGGGCGG + Intergenic
1083443403 11:62691352-62691374 GCTGAGGAAGGTGAAGTTGCTGG + Exonic
1084681115 11:70666981-70667003 GCTGTGGAAGGTGAAGGGGGTGG + Intronic
1084971402 11:72774211-72774233 GCTGCCTAATGGGAAGTAGGGGG - Intronic
1089589329 11:119530462-119530484 GCTGGGGAAGGGGAACTTGAAGG + Intergenic
1091920826 12:4303247-4303269 GCTGCCGATGGGAAAGTCGGGGG + Exonic
1095954808 12:47799873-47799895 CCTGGAGAAGGGGAAGTGGGTGG + Intronic
1098965573 12:76784486-76784508 GATGTTGAAGGTGAAGCTGGTGG + Intronic
1100610587 12:96188923-96188945 GCTGGGGAAGGGAAAGATGGGGG + Intergenic
1102147630 12:110666837-110666859 GCTCTCGAAGGAAAAGTGGGAGG - Intronic
1102977225 12:117215324-117215346 CCTGTGGAAAGAGAAGTTGGGGG + Exonic
1103916223 12:124376998-124377020 CCTGTCAAAGGGGAAGCTGGGGG - Intronic
1104548343 12:129732604-129732626 CTTGTGGAAGGGGAAGTGGGAGG - Intronic
1104934764 12:132358511-132358533 GCTGTCTACGGGGATGTTTGGGG + Intergenic
1105055430 12:133094618-133094640 GCTCTCTAAGGAAAAGTTGGGGG - Intronic
1117580185 14:57143959-57143981 GTTATAGGAGGGGAAGTTGGGGG + Intergenic
1119892008 14:78189887-78189909 GTTGTGGAAAGGGTAGTTGGGGG - Intergenic
1120802023 14:88701007-88701029 CCTGGCAGAGGGGAAGTTGGGGG - Intronic
1121721420 14:96111524-96111546 GCTCCAGAAGGGGAAGTTGCTGG + Intergenic
1122389948 14:101373382-101373404 GCAGCAGAAAGGGAAGTTGGAGG - Intergenic
1124093224 15:26625302-26625324 GGTGTGGAAGGAGGAGTTGGTGG - Intronic
1124655914 15:31507147-31507169 ACTGAAGAAGGGGAAGATGGGGG + Intronic
1126468785 15:48984991-48985013 GCTGGCCAGGGTGAAGTTGGCGG + Intergenic
1130969032 15:88718054-88718076 GCGGCAGAAGGGGAAGATGGGGG - Intergenic
1132934394 16:2473566-2473588 GCGTTCCAAGGGGAAGCTGGCGG - Intronic
1135716612 16:24775527-24775549 AGTGTGGAAGAGGAAGTTGGTGG + Intronic
1137039448 16:35597045-35597067 ACTGAAGAAGGGGAAGATGGGGG + Intergenic
1137355926 16:47763648-47763670 ACTCTGGAAGGGGAAGTAGGGGG - Intergenic
1143924127 17:10354737-10354759 GCTCACGAAGGGGAAGTCGAAGG + Exonic
1145973031 17:28968080-28968102 GCTGTCCAAGCTGATGTTGGAGG - Intronic
1146110477 17:30084667-30084689 GCTGCAGAAGGGGAAGAGGGAGG - Intronic
1148344795 17:46895930-46895952 GGTCTTGAAGGGGAAGCTGGTGG + Intergenic
1148477288 17:47937100-47937122 GTTGTCTAAGTGGAAGGTGGGGG - Intergenic
1148835935 17:50465772-50465794 GCTGTCGAAGGGGAAGTTGGAGG + Exonic
1151522684 17:74641570-74641592 GCTGGGGAAGGGGAGGTGGGTGG - Intergenic
1151831125 17:76551894-76551916 GCTGTGAAATGGGAAGGTGGGGG + Intronic
1151833503 17:76569301-76569323 GCTGTAGAAGGAGGACTTGGGGG + Intronic
1151875703 17:76867186-76867208 GCTGGCTAAGGAGATGTTGGAGG - Intergenic
1155723230 18:29045905-29045927 CCTGTCGAAGGGGGAGATTGGGG - Intergenic
1156108070 18:33690105-33690127 GCTTTGGGAGGTGAAGTTGGTGG - Intronic
1156213997 18:34977618-34977640 GCTGCCGAAGGGGAAGTGCCCGG - Intronic
1156973477 18:43186975-43186997 GCTGGAGAATGGGAAGTAGGTGG - Intergenic
1158685334 18:59608942-59608964 GCTGTGTAAGTGGAAGGTGGGGG - Intronic
1158844862 18:61431159-61431181 ACTGTGGAAGGGGAGGTTGCAGG - Intronic
1158932099 18:62332666-62332688 CCTGGGGAAGGGGAAGTTGTGGG - Intronic
1162331490 19:10032610-10032632 CCTCTCGAAGGGGAAATTGCTGG + Intergenic
1162733753 19:12734435-12734457 GCTGTTCAAGCGGAAGATGGAGG - Exonic
1163823237 19:19508232-19508254 CCTGTTGTAGGGGAGGTTGGGGG + Exonic
1163976930 19:20861550-20861572 ACTGAAGAAGGGGAAGATGGGGG - Intronic
1166147200 19:40845895-40845917 CCAGTCGAAGGGGAATTTTGAGG + Intronic
1166151357 19:40877791-40877813 CCAGTCGAAGGGGAATTTTGAGG + Intronic
1167462744 19:49634970-49634992 CCTGTTGAAGGGAAAGTGGGGGG + Intergenic
1167499648 19:49837880-49837902 GCTGTGGATGGGGAAGACGGTGG + Intronic
925880230 2:8346042-8346064 GCTGTCAAAGTGGAATCTGGGGG - Intergenic
926776187 2:16425597-16425619 GCTGTAGAAGGGGTAGGGGGAGG - Intergenic
927698140 2:25251538-25251560 GCAGTCGCAGGGGGAGGTGGAGG - Intronic
927892387 2:26759878-26759900 GCTGTCTTAGGGCAAGTAGGAGG + Intergenic
929456991 2:42073033-42073055 GGTGCAGAAAGGGAAGTTGGAGG + Intergenic
936908139 2:117561342-117561364 GCTGTCCAAGGTAAAGGTGGAGG + Intergenic
937202145 2:120210517-120210539 TCTGTCAAAGGGGGAGGTGGGGG - Intergenic
938428354 2:131210317-131210339 CCTGTGGAAGGGGTGGTTGGGGG + Intronic
938717120 2:134030775-134030797 GCTGGGGAAGGAAAAGTTGGAGG - Intergenic
941377032 2:164744382-164744404 TCTGTGGAAGGGGTAGTTTGGGG - Intronic
943710029 2:191082656-191082678 GCTGTGGAAGGGGAATTTGAAGG - Intronic
946919692 2:224566066-224566088 CCTGTAGATGGGGAAGGTGGGGG - Intronic
948469001 2:238165540-238165562 TGTGTCGTAGGTGAAGTTGGTGG + Intronic
1169200384 20:3706399-3706421 GATCTCGAAGCGGAAGTTGTAGG + Exonic
1169394918 20:5220587-5220609 ACTGTGGAAGGGGAAGTGGGAGG - Intergenic
1173579018 20:44132982-44133004 GCTGTGGAGGGGGATGGTGGGGG - Intronic
1179080206 21:38163703-38163725 GGAGTAGAAGGAGAAGTTGGAGG - Intronic
1179394490 21:41025388-41025410 GATGTCAAAGGTGAATTTGGGGG + Intergenic
1181629644 22:24143848-24143870 GCTGTCCAAGGGGAAGAGCGAGG - Intronic
1184759671 22:46537348-46537370 GCTCTCGAAGTGGAAGCTGCGGG - Intergenic
950222495 3:11206904-11206926 GCTGAGGAGGGGGAAGCTGGAGG + Intronic
951117944 3:18887166-18887188 GCAGTCAAAGCAGAAGTTGGGGG - Intergenic
954128966 3:48550079-48550101 GCTGTCTAAGGGGAGCTTTGTGG - Intronic
955834860 3:63043801-63043823 CCTGTTGAAGAGGGAGTTGGAGG - Intergenic
956084713 3:65597410-65597432 GCTTTTGAAGGGGATGCTGGAGG - Intronic
958049278 3:88323738-88323760 CGTGTCGAAGGGGAACCTGGTGG + Intergenic
959840198 3:110966456-110966478 ACTGAAGAAGGGGAAGATGGGGG + Intergenic
967812418 3:193771967-193771989 GCTGTTGAAGGGGCTGATGGCGG + Intergenic
969280392 4:6166912-6166934 GGTGGAGGAGGGGAAGTTGGGGG - Intronic
972346452 4:38196514-38196536 GCAGGAGAAGGGGGAGTTGGAGG + Intergenic
972422839 4:38905793-38905815 GCTGATGAAGGGGAAGTGGGTGG - Exonic
975228173 4:71899212-71899234 TCTGTTGAAGGGGTAGATGGTGG - Intergenic
978553675 4:109955232-109955254 GTTATTGAAGGGGCAGTTGGTGG + Intronic
983595853 4:169467000-169467022 GCTGAAGAGGAGGAAGTTGGGGG - Intronic
983957126 4:173710738-173710760 GCTGTGGAAGGGGTAGGAGGTGG + Intergenic
986854832 5:11856335-11856357 GCTGTGGAAGGGGAGGCTGATGG + Intronic
988151488 5:27387664-27387686 GCTGTGGTGGGGGAAATTGGAGG + Intergenic
992737556 5:79738594-79738616 GCTGCAGAAGGGGAAATTTGGGG + Exonic
994671043 5:102762137-102762159 GCTGAGGAAGGGGAATTTGGGGG - Intronic
995384200 5:111570589-111570611 GCTGTTGTGGGGGGAGTTGGGGG - Intergenic
995912535 5:117204625-117204647 GCTGGCGAAGGGGGAGGGGGGGG + Intergenic
998238708 5:140422989-140423011 GGTGTGGAAGGGGAGGTTTGAGG - Intronic
999347183 5:150834288-150834310 ACTGAAGAAGGGGAAGATGGGGG + Intergenic
999619264 5:153455696-153455718 GCTTTGGAAGGGGAAGTGGATGG - Intergenic
999779374 5:154836604-154836626 GGTGTCAGAGGGGATGTTGGAGG + Intronic
1001246071 5:170106418-170106440 GTTGTAGAAGGGGAAGTTGTCGG - Exonic
1002704523 5:181151271-181151293 GCTGCGGGAGGGGAAGTGGGGGG + Intergenic
1005429150 6:25736095-25736117 GCTGTTGAAAGAGAAGGTGGTGG + Intergenic
1006742510 6:36319661-36319683 GTTGTGGGAGGGGCAGTTGGCGG - Intronic
1007631981 6:43277654-43277676 GCCGGGGAAGGGGAAGGTGGCGG - Intronic
1008004096 6:46391663-46391685 GCTGTGACAGTGGAAGTTGGAGG + Intronic
1013317604 6:108957262-108957284 GCTGTGTAAGGGGAAGGTGGAGG - Intronic
1014006076 6:116419619-116419641 GCTGGCAAATGGGAAGCTGGTGG + Intronic
1014199576 6:118593775-118593797 GCTGTTGAAGTAGAAGCTGGTGG - Intronic
1022535604 7:31096405-31096427 GCTGTGGAAGTGGAAGATGGAGG - Intronic
1023256900 7:38321501-38321523 GCTGTTGAAGGAGAAGTGGAAGG + Intergenic
1023640436 7:42251460-42251482 GCTGGAGTAGGGGGAGTTGGGGG + Intergenic
1024324278 7:48096516-48096538 ACTGGGGAAGGGGAAGTGGGAGG - Intronic
1024602725 7:50998661-50998683 GCTGTGGAAGGGCAAGTGGAAGG + Intergenic
1025875535 7:65477218-65477240 GCTCTCGCAGGGGAAGTAAGGGG - Intergenic
1030747729 7:113188170-113188192 ACTGTTGAAAGGGCAGTTGGAGG - Intergenic
1030985710 7:116239231-116239253 GCAGCAGAAGAGGAAGTTGGAGG - Intronic
1031439599 7:121777584-121777606 GTTGCCCAAGGGGAAGTTTGAGG - Intergenic
1032840363 7:135708360-135708382 GCTGGCGAAGGGGAGGCAGGGGG + Intronic
1034165421 7:149021703-149021725 AATGTCCCAGGGGAAGTTGGAGG + Intronic
1035476111 7:159145074-159145096 GCAGCGGAAGGGGAAGTGGGGGG - Intergenic
1036789549 8:11708848-11708870 GCTGTCGAAGGGGCCGGCGGAGG - Exonic
1040533105 8:48282145-48282167 GTGGTAGAAGGGGAAGGTGGCGG - Intergenic
1040897907 8:52388384-52388406 GTTGTGGAAGTGGGAGTTGGAGG - Intronic
1041113163 8:54506702-54506724 GCTGTCCAGGGGGAAGCAGGTGG + Intergenic
1042076281 8:64998502-64998524 GCTGAGGAAGAGGAATTTGGTGG - Intergenic
1044948597 8:97414375-97414397 GCTGTAGAAAAGGAAGGTGGGGG - Intergenic
1049941212 9:547814-547836 GCTGTGAAAGAGGAAGGTGGTGG + Intronic
1050369480 9:4905962-4905984 GCTTTTGAAGGGGAAGCTGTTGG + Intergenic
1055329492 9:75169000-75169022 GAGGTTGCAGGGGAAGTTGGGGG - Intergenic
1055731068 9:79279694-79279716 GCTAGGGGAGGGGAAGTTGGAGG + Intergenic
1057361265 9:94375286-94375308 ACCGTCGACGGGGAAGTTGGCGG + Intronic
1057641781 9:96830584-96830606 ACTGTGGCAGGGGAGGTTGGGGG - Intronic
1057662100 9:97012883-97012905 ACCGTCGACGGGGAAGTTGGCGG - Intronic
1057785329 9:98083165-98083187 GCTGTCTAAGGAGCAGGTGGAGG - Intronic
1062010307 9:134263540-134263562 GCTGTGGAAGGGGCCGTGGGTGG - Intergenic
1192601312 X:72467443-72467465 GGTGACGATAGGGAAGTTGGAGG + Intronic
1199638090 X:149832607-149832629 ACTGAAGAAGGGGAAGATGGGGG - Intergenic