ID: 1148835936

View in Genome Browser
Species Human (GRCh38)
Location 17:50465773-50465795
Sequence CTGTCGAAGGGGAAGTTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 140}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835926_1148835936 11 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG 0: 1
1: 0
2: 0
3: 19
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835936 Original CRISPR CTGTCGAAGGGGAAGTTGGA GGG Exonic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
901932044 1:12602183-12602205 CTTGTGCAGGGGAAGTTGGATGG + Intronic
902398998 1:16147341-16147363 CTGTTGAGGGAGAGGTTGGAGGG - Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903927462 1:26840853-26840875 CAGTTGAAGGGAAAGTTGAAGGG - Intronic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904051226 1:27640216-27640238 CTGTGGAAGGAAAAGCTGGATGG - Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
907087548 1:51690398-51690420 TTGTCGAAGTGGAAGTTGTGGGG + Intronic
907593095 1:55694376-55694398 CTGTAGAGTGGGAGGTTGGATGG + Intergenic
908934824 1:69362656-69362678 CTGTCGAATGGGAAAGTGGGAGG - Intergenic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
911679266 1:100695479-100695501 CTGTCTAAGTGGAAGATGCATGG + Intergenic
911718597 1:101165221-101165243 CTGCTGAAGGGTAAGTAGGAAGG + Intergenic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
917943410 1:179945956-179945978 CTATCGAAGGTGGAGGTGGAAGG + Intergenic
919745983 1:201009453-201009475 CTGTCGAAGGAGAAGATTGAGGG - Exonic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1074910015 10:117899928-117899950 CTATTGAATGGGAAGATGGAAGG - Intergenic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1082740629 11:56907103-56907125 CTGTGGAAAGGGAAGGTGGGCGG + Intergenic
1089073448 11:115718290-115718312 CTGCCCAAGGGGAAGTCGCAAGG + Intergenic
1089187087 11:116625442-116625464 CTGTGGAAGGATAAGGTGGAAGG + Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1092034700 12:5322854-5322876 CTGTCGGAGGGGGACTTGTAGGG - Intergenic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1102295036 12:111729905-111729927 CTGCTGACGGGGAAGATGGAGGG - Exonic
1102427301 12:112854010-112854032 CTGTAAAATGGGAAGTTGGATGG + Intronic
1102875429 12:116445132-116445154 GTGTCCAAGGGGGAGTTGGCAGG + Intergenic
1102977226 12:117215325-117215347 CTGTGGAAAGAGAAGTTGGGGGG + Intronic
1103225242 12:119281871-119281893 GTGTCGAGGGGGTAGGTGGAGGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1105472650 13:20706125-20706147 CTGCCCACGGGGAAGTTGGGTGG + Intronic
1113055534 13:106263118-106263140 CTCTTGAAGTGGAAGGTGGAAGG - Intergenic
1113505982 13:110816233-110816255 CTTTCCAAGGGGTTGTTGGAAGG - Intergenic
1114816485 14:25964918-25964940 CTGTGAAAGGGAAAGTTGAAGGG - Intergenic
1116095879 14:40366818-40366840 CTGTCGAAGAGACAGTGGGAAGG - Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122539017 14:102486543-102486565 CTGTGGAAGGGGCAGTTTCATGG - Intronic
1125050635 15:35294500-35294522 CTGTTGAAGTTGAAGTTGCAAGG - Intronic
1126111277 15:45176187-45176209 TTGTCGAAGGGAAAGTTTCAAGG - Intronic
1129336828 15:74857208-74857230 CTGTCGCAGAGGAGGTTGGAAGG - Intronic
1136504172 16:30692246-30692268 CTGGTGAAGTGAAAGTTGGATGG - Intergenic
1137355925 16:47763647-47763669 CTCTGGAAGGGGAAGTAGGGGGG - Intergenic
1137748487 16:50841129-50841151 CTGGGAAAGGAGAAGTTGGAAGG + Intergenic
1140700946 16:77581077-77581099 CTGTCCAAGGAGAAGATGGCTGG + Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1142755042 17:2011468-2011490 CTGTGGGAGGGGAAGATGAAAGG + Intronic
1143924128 17:10354738-10354760 CTCACGAAGGGGAAGTCGAAGGG + Exonic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148580422 17:48739460-48739482 CTGTTGAATCCGAAGTTGGATGG + Intergenic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149835214 17:59906365-59906387 CTGTCGAAAGGGAAGGGGAAGGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151288993 17:73134942-73134964 GTGTGGAAGGGGAAGATGGCTGG + Intergenic
1151875702 17:76867185-76867207 CTGGCTAAGGAGATGTTGGAGGG - Intergenic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1160719829 19:592233-592255 CTGTCGAAGGTCATGCTGGAGGG - Intronic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1166147201 19:40845896-40845918 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166151358 19:40877792-40877814 CAGTCGAAGGGGAATTTTGAGGG + Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167633214 19:50638696-50638718 CGGTCGAACGGGAGGATGGATGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929049490 2:37823923-37823945 GTGACGAAGTGGAAGTTGCAAGG + Intergenic
929340293 2:40807511-40807533 CTGCCTAAGAGGAAGTTGAAAGG - Intergenic
930122956 2:47774823-47774845 CTGTAGTAGGAGAAGTTGAAGGG + Intronic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
935800693 2:106692305-106692327 CTGCAGAAGGGGCAGGTGGAGGG + Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937219436 2:120333308-120333330 CTGCTGAAGAGGTAGTTGGATGG - Intergenic
937332894 2:121043172-121043194 CTGCCGAAGGGCAGGTTGGGAGG + Intergenic
937584328 2:123527423-123527445 CTGTGGAAGGGGAAGGGGAATGG + Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
939001805 2:136745388-136745410 CTTTCGAGTGGAAAGTTGGAAGG - Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
943746049 2:191463711-191463733 ATGTAGAAGGGGTAGCTGGATGG - Intergenic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
946919691 2:224566065-224566087 CTGTAGATGGGGAAGGTGGGGGG - Intronic
948071970 2:235135166-235135188 CTGTCCAAGGGTGAATTGGAAGG - Intergenic
948088118 2:235267500-235267522 CTGTGGCAGGAGAGGTTGGAAGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1170083698 20:12505556-12505578 CTGTAGCAGTGGAAGTAGGAGGG + Intergenic
1172044969 20:32073827-32073849 CTGTCTTAGGGGGAGTGGGATGG - Intronic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1175751329 20:61499902-61499924 CTGTGGCAGGGGTGGTTGGAAGG + Intronic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
953695185 3:45152723-45152745 TTGTATAAGGGGAAGTTTGATGG + Intergenic
958049279 3:88323739-88323761 GTGTCGAAGGGGAACCTGGTGGG + Intergenic
958811524 3:98865444-98865466 GGGTTGAAGGGGGAGTTGGAGGG + Intronic
960395392 3:117131090-117131112 ATGTCGAAGAGGAAGCTGGACGG + Intronic
960593845 3:119390711-119390733 CTGTGGATGGGGAATCTGGATGG + Intronic
962108189 3:132415520-132415542 CTGTAGCAGGGGTAGTTAGAAGG + Intergenic
965327470 3:167324890-167324912 TTGTAGAAGAAGAAGTTGGAAGG - Intronic
968241632 3:197093843-197093865 CTGTCGATGGGGAAATTGCAAGG - Intronic
972110830 4:35557209-35557231 CTGTGGAAGTGGAAGTGGTATGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972362847 4:38344961-38344983 CTGTCATAGTGGAAGTTGAAGGG - Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
975228172 4:71899211-71899233 CTGTTGAAGGGGTAGATGGTGGG - Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
988445344 5:31280130-31280152 CTGAAGAAGGGGAAGGTGTAGGG + Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
991402925 5:66273126-66273148 CTGCTGAAGGGGAAGCTGGAAGG - Intergenic
997691228 5:135828815-135828837 CTGTAGGAGGGGCAGCTGGAAGG - Intergenic
997872046 5:137514862-137514884 CTCTAGAAGGAGAAGTTGCAGGG + Intronic
998188325 5:140000365-140000387 CTGCGGCAGGGGAAGCTGGAAGG - Intronic
1002508115 5:179694662-179694684 AAGTCGAAAGGGAAGTTTGATGG + Intronic
1004878395 6:19979470-19979492 CTGTCAAAGGTGAAGTAGAAAGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1024184863 7:46939725-46939747 CGGCAGAAGAGGAAGTTGGAGGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1032155377 7:129463469-129463491 TTTTCAAAGGGGAAGATGGAAGG - Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034697642 7:153068157-153068179 CTGCAGAAGAGGAAGCTGGAAGG + Intergenic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1039743950 8:40406966-40406988 CTGTCTAAAGGGATGTTGGCAGG - Intergenic
1040599329 8:48869211-48869233 CAGTGGACGGGGAAGTGGGAAGG + Intergenic
1042214722 8:66418728-66418750 CTGTTGAATGGTAAGTTGGCTGG - Intergenic
1042587652 8:70359553-70359575 CTCTTGAAGGGGAAGTTACAAGG + Intronic
1042871712 8:73405656-73405678 TTGGGGAAGGGGAAGCTGGAAGG - Intergenic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1051212485 9:14759264-14759286 CTTTCGAAGGCCAAGGTGGATGG + Intronic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1055400178 9:75915087-75915109 CTTTCCTAGGGGAAGTTAGAAGG + Intronic
1056879828 9:90380517-90380539 CTGGGGGTGGGGAAGTTGGAAGG - Intergenic
1057641780 9:96830583-96830605 CTGTGGCAGGGGAGGTTGGGGGG - Intronic
1058001812 9:99873455-99873477 CTGTAGCAAAGGAAGTTGGAAGG + Intergenic
1059297949 9:113289041-113289063 CTTTAGAAGGGGGAGTTGGCTGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1187128348 X:16475686-16475708 CTGTGGAGGGGGAAGTTAGGAGG + Intergenic
1187483313 X:19678136-19678158 CTGATGAAGGCAAAGTTGGAAGG - Intronic
1188411696 X:29880684-29880706 CTGTCAAAAGGGAAGTTTGATGG - Intronic
1189416205 X:40816594-40816616 CTGTTGAATGGAAAGTGGGATGG - Intergenic
1189586869 X:42470766-42470788 CTGTTGAAGGGGAATCTGGGTGG - Intergenic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic