ID: 1148835937

View in Genome Browser
Species Human (GRCh38)
Location 17:50465780-50465802
Sequence AGGGGAAGTTGGAGGGTAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835926_1148835937 18 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835937 17:50465780-50465802 AGGGGAAGTTGGAGGGTAGCTGG 0: 1
1: 0
2: 1
3: 45
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835937 Original CRISPR AGGGGAAGTTGGAGGGTAGC TGG Exonic
900316886 1:2061403-2061425 AGGGGAGGTTGGGGGGTCACAGG + Intronic
900499386 1:2993362-2993384 ATGGGAGGGTGGAGGGTAGGAGG + Intergenic
901105373 1:6751838-6751860 AGGGGAAGTGGAAGGGGAGGGGG - Intergenic
901343014 1:8512537-8512559 AGGGGAGATTGGAGGGCAGTTGG - Intronic
901489772 1:9590626-9590648 AGGGGAACTAGGAGGGTGCCTGG + Intronic
901932046 1:12602190-12602212 AGGGGAAGTTGGATGGTTGTGGG + Intronic
902410534 1:16209017-16209039 AGGTGGGGCTGGAGGGTAGCAGG + Exonic
902611496 1:17600242-17600264 AGGGGAAGAGGGAGGGGAGGAGG - Intronic
902987865 1:20166404-20166426 AGGGGGAGTGGGAGGGCAGAGGG - Intronic
903063618 1:20686226-20686248 AGGGGAGGTTGGGGGGTGGTGGG - Intronic
903301037 1:22379063-22379085 AGGGGTTGTGGGAGGGGAGCAGG - Intergenic
903360663 1:22775037-22775059 AGGGGCAGGAGGAGGGCAGCAGG - Intronic
904646872 1:31974328-31974350 TGGGGAAGTGGGAGGTTGGCAGG - Intergenic
904726144 1:32549762-32549784 AGGGGAAGTTCAGGGGTAGCAGG - Intronic
905013112 1:34760235-34760257 TGGGGAAGGAGGAGGGTAGGAGG + Intronic
905201327 1:36319185-36319207 GGGGGAAGGAGGAGGGTAGGAGG + Intronic
905483407 1:38277150-38277172 AAGGGAATTTGGGGGGTTGCTGG - Intergenic
906058107 1:42931414-42931436 AGGGGAAGTGGGAGAGTTGGCGG - Intronic
906313949 1:44774225-44774247 AAGGGTAGTGGGAGGGTAGGGGG + Intergenic
906511145 1:46411076-46411098 TGGGGGAGTTGGAGGGGAGGAGG + Intronic
907958896 1:59259964-59259986 AGTGGAAGTTGGAGGGGATTGGG - Intergenic
908528241 1:65008609-65008631 AGGGGAAGGGGAAGGGGAGCAGG - Intergenic
908681014 1:66660948-66660970 ATGGGGAGTTGTAGGGAAGCTGG + Intronic
909924600 1:81424776-81424798 AGGTAAAGTTGGAAGGTAACTGG - Intronic
910297484 1:85664616-85664638 AGGTGAAGGTGGAGGGTGGGAGG + Intronic
910620048 1:89243646-89243668 AGGGCTTGTTGGAGGGTAGGGGG - Intergenic
910632901 1:89374901-89374923 AGGGGAAGAGGGAGAGAAGCAGG - Intronic
910879905 1:91913901-91913923 GGGGGTAGGTGGAGGGTTGCAGG + Intergenic
910937336 1:92495176-92495198 GGAGGAAGTTGGAGGGCAGGTGG + Intergenic
911122579 1:94310941-94310963 AGGGCAAGTGGGAGAGTAGAAGG - Intergenic
912821146 1:112868774-112868796 AGGGGAGGTTGGGGAGAAGCTGG - Intergenic
912949204 1:114108994-114109016 AGGGGTTGTGGGAGGGTAGGGGG + Intronic
913688543 1:121256822-121256844 AGGGGAAGGTGGGGGGTAGATGG + Intronic
914040399 1:144044465-144044487 AGGGGAAGGTGGGGGGTAGATGG + Intergenic
914149057 1:145023455-145023477 AGGGGAAGGTGGGGGGTAGATGG - Intronic
914995970 1:152543613-152543635 GGGGGCAGTTGGAGGCCAGCTGG + Intronic
915100689 1:153497186-153497208 GAGGGAGGTTGGAGGGAAGCGGG - Intergenic
915527795 1:156486986-156487008 AGGGGTGGTTGGAGGGTAGGTGG - Intronic
915589613 1:156862999-156863021 AGGGAAAGTTAGAGGGTAGAGGG + Intronic
915624487 1:157106448-157106470 AGGGGAAGGTCGAGGGGCGCAGG - Intergenic
915878802 1:159643426-159643448 AGGGGAAGGGGGAGGGGAGGGGG + Intergenic
915937991 1:160100000-160100022 GGAGGATGTTGGAGGGTAGAGGG - Intergenic
916544042 1:165785338-165785360 GGGTGAAGTGGGAGGATAGCTGG - Intronic
917225324 1:172775587-172775609 AGGGGTTGTTGGAGGATAGTTGG - Intergenic
917620733 1:176793220-176793242 AGGGGATCTTGGAGGCCAGCTGG + Intronic
919335946 1:196233911-196233933 AGGGGAAGATGGAGAGAAACTGG + Intronic
920475865 1:206275321-206275343 AGGGGAAGGTGGGGGGTAGATGG + Intronic
921023845 1:211259759-211259781 AGGGGAAGAGGGAGGGGGGCAGG - Intronic
921246319 1:213245517-213245539 AGGTGAAGTGGCAGGGTAGAGGG - Intronic
921634928 1:217481009-217481031 AAGGGGAGTGGGAGGGTAGCAGG + Intronic
921756666 1:218864676-218864698 AAGGGAAGGGGGAAGGTAGCAGG - Intergenic
923341605 1:233012305-233012327 AGGGGAGGTTGGAGCCTGGCAGG - Intronic
923442771 1:234037212-234037234 GGTGGAAGGTGGAGGGGAGCAGG + Intronic
1063207571 10:3849115-3849137 AGGGGAAGGGGGAGGGGAGGGGG - Intergenic
1063960346 10:11301366-11301388 GGGGGAAGTGGGGGGGAAGCGGG - Intronic
1066052541 10:31648805-31648827 TAGGGAAGGTGGAGGGTGGCTGG + Intergenic
1066506273 10:36048026-36048048 ATTGGAAGGTGGAGGGTAGGAGG + Intergenic
1067190557 10:44064484-44064506 AGGGGAGGCTGGAGGGAGGCTGG - Intergenic
1068120585 10:52779326-52779348 AGGGGAAGAGGGAGGGAAGGTGG - Intergenic
1068120593 10:52779346-52779368 AGGGGAAGAGGGAGGGAAGGAGG - Intergenic
1068120601 10:52779366-52779388 AGGGGAAGAGGGAGGGAAGGAGG - Intergenic
1068120609 10:52779386-52779408 AGGGGAAGAGGGAGGGAAGGAGG - Intergenic
1068399801 10:56513551-56513573 AGAGGAGGCTGCAGGGTAGCAGG + Intergenic
1068926340 10:62543263-62543285 AGGGGAAGATGTAGGTCAGCAGG + Intronic
1069704742 10:70451262-70451284 AGGGGAAGTGGGAAGGTGGGAGG - Intergenic
1069916525 10:71790225-71790247 AGGGGAGGTGGGAGGGCAGGGGG + Intronic
1070564620 10:77594325-77594347 AGGGGAAATTGGTGGCTGGCTGG - Intronic
1071451949 10:85803078-85803100 AAGGGTAGTTGGAGGGTAAGTGG + Intronic
1072942966 10:99783989-99784011 AGTGGAAGTTGGGGGGTGGGGGG - Intronic
1073001857 10:100291687-100291709 AGGGGAAGCTGGGGGATAGCAGG - Intronic
1073143644 10:101264979-101265001 AGGGGAAGTGGGGAGGTAGTGGG + Intergenic
1073258575 10:102171613-102171635 AGGGGAAGCTAGAGGGTTGGGGG + Intergenic
1073315724 10:102579407-102579429 AGGGGAGGTGGGAGGCTGGCGGG - Intronic
1074927719 10:118090875-118090897 AGGGGAAGCTGGACAGTGGCTGG + Intergenic
1075488486 10:122846969-122846991 AGGGGAGGATGGAGAGGAGCAGG + Intronic
1075599888 10:123759782-123759804 AGGAGAAGGTGCAGGGTTGCAGG + Intronic
1075630068 10:123995365-123995387 AGGAGAAGTAGGAAGATAGCGGG + Intergenic
1075856958 10:125637939-125637961 AGGGGAAGTTGGAGGGGGCCCGG - Intronic
1076096773 10:127738965-127738987 AAGGGAGGCTGGAGGCTAGCCGG + Exonic
1076517436 10:131055631-131055653 AAGGGAACTTGGCGGGAAGCAGG - Intergenic
1076588995 10:131570407-131570429 AGGGGGAGAAGGAGGGGAGCAGG + Intergenic
1076740120 10:132478694-132478716 AGGGGCAGTTGCTGGGTGGCAGG + Intergenic
1076898974 10:133327840-133327862 AGGAGAAGGTGGAAGGCAGCTGG - Intronic
1077271560 11:1684421-1684443 CGGGGAAGGAGGAGGGGAGCAGG + Intergenic
1077294762 11:1820992-1821014 AGGCCAAGGTGGAGGGAAGCTGG - Intergenic
1077663972 11:4092177-4092199 AGGGGAAGTTGGGGAGTGGTGGG - Exonic
1078479678 11:11664884-11664906 AGGGTGATTTGGAGGGTGGCAGG - Intergenic
1079987703 11:27215966-27215988 AGGTGAAGTGGGGAGGTAGCGGG + Intergenic
1080121608 11:28684442-28684464 AGGGGATGGTGGAGGGTGGGAGG + Intergenic
1080213804 11:29817946-29817968 GGGGGCGGTTGGAGGGTGGCTGG + Intergenic
1080298196 11:30754079-30754101 AGGGGAAGCTGAAGGCTAACAGG - Intergenic
1082273902 11:50200968-50200990 TGGGGAAGTTGGAGGATTCCTGG + Intergenic
1083427715 11:62597290-62597312 AGCAGAAGTTGGTGGGTAGTTGG - Intronic
1083587382 11:63870124-63870146 AGGACAAGTGGAAGGGTAGCAGG + Intronic
1084772642 11:71353828-71353850 AGGGGAAGATGGAGGGAGGGAGG + Intergenic
1085134685 11:74075378-74075400 GGGGGAAGTAGGAGGTTAGCAGG + Intronic
1085353748 11:75817037-75817059 AGTGGGAGTTTGAGGGTAGTGGG + Intronic
1085732741 11:79013317-79013339 GGGGCAAATTGGAGGGTATCTGG - Intronic
1086756418 11:90569375-90569397 TGGGGAGGTTGGGGGGTGGCGGG - Intergenic
1087635214 11:100694572-100694594 AGGTGAAATTGGTGGGTGGCAGG - Intronic
1089009522 11:115121190-115121212 AGGGGGAGTGGCAGGGCAGCAGG + Intergenic
1089058357 11:115606236-115606258 AGTGGAAGGTGGAGGGTGGAGGG - Intergenic
1089542134 11:119195753-119195775 ATGGGAAGAGGGAGGGGAGCAGG - Intronic
1090750518 11:129743062-129743084 AGGGGAGGTGAGAGGGTGGCTGG - Intergenic
1090860321 11:130647286-130647308 AGTGGAAGGTGAAGGGGAGCAGG + Intergenic
1091010345 11:131995522-131995544 AGGCAAAGTTGTAGGGGAGCAGG + Intronic
1091138254 11:133212336-133212358 AGGGGCAGTGGGAGAGTGGCAGG - Intronic
1091674814 12:2481495-2481517 AGGGGAGGATGGAGTTTAGCCGG - Intronic
1091976106 12:4827075-4827097 AGGGGACGATGGAGGGGAGGAGG - Intronic
1092261432 12:6955281-6955303 AGGGGAAGTGGGGAGGCAGCTGG - Intronic
1092817135 12:12322177-12322199 AGGGGATGCTGGAGGGATGCAGG + Intergenic
1092846264 12:12588094-12588116 AAGTGAAGTTGTAGGGGAGCCGG - Intergenic
1094206375 12:27844677-27844699 ATTGGGACTTGGAGGGTAGCGGG - Intergenic
1094599728 12:31898135-31898157 AGGGGAATTGGCAGGGGAGCAGG - Intergenic
1096017126 12:48286761-48286783 AGGGGAAATTGAAGGGAAGCAGG - Intergenic
1096242820 12:49968348-49968370 AGGGGAAGGAGGAAGGTACCGGG - Intronic
1097068713 12:56339278-56339300 AGTGGAAGCTGGAGGGTTGAAGG + Intronic
1097319650 12:58211039-58211061 AGCGGAAGCTGGAGGTTGGCAGG + Intergenic
1099189961 12:79552344-79552366 AGGGAAAATTGGAAGGTACCGGG + Intergenic
1100452407 12:94720065-94720087 AGGGGAAGTGGGAAGATGGCTGG + Intergenic
1100463072 12:94819940-94819962 AGAGGAAGCTGGATGGTGGCAGG + Intergenic
1100670740 12:96809880-96809902 AGGGGCTGTTGTGGGGTAGCAGG + Intronic
1101435122 12:104657941-104657963 AGGGGGATTTTGAAGGTAGCAGG + Intronic
1101575357 12:105992249-105992271 AGGGTAAGTTGGAGGGTCAGTGG + Intergenic
1101912613 12:108871802-108871824 AGGGTAATTTGGTGGGTAGGGGG - Intronic
1101936442 12:109061814-109061836 TGGGAAAGGTGGAGGGGAGCAGG - Intronic
1102035462 12:109768499-109768521 AGGGCAGGTTGGAAGGTGGCAGG - Exonic
1102223096 12:111208041-111208063 AGGGGAAGTGGGAGGGACCCAGG + Intronic
1102524205 12:113499697-113499719 AGGCGAAGCTGGAGGGGAGTAGG + Intergenic
1102844014 12:116158261-116158283 AGGGGAAGGTGAAGGGAAGAGGG + Intronic
1104140030 12:125979082-125979104 GGGGGAAGTTGAAGGGGAGCTGG + Intergenic
1104753397 12:131254125-131254147 ATGGGAAGATGGTGGGGAGCAGG - Intergenic
1107002140 13:35560258-35560280 AGGTGAAGTTGTATGGTACCAGG - Intronic
1107106088 13:36644372-36644394 AGGGGAGGTGGGAGGGTGGGGGG - Intergenic
1107560023 13:41550325-41550347 AGGGGAGGCTGGAGGCTGGCTGG + Intergenic
1107678799 13:42825775-42825797 ATGAGAAGTTGGAGGGAATCTGG - Intergenic
1107868580 13:44727104-44727126 AGGGTAATTTGGTGGGTAGGGGG - Intergenic
1108985457 13:56580604-56580626 AATGGAAGATGGAGGGTAGGGGG + Intergenic
1109992534 13:70077664-70077686 AGGGGAAATTGGAGGATAATGGG + Intronic
1112441388 13:99427020-99427042 AGGGGAGGGTGGAGGGGAGGAGG + Intergenic
1113513655 13:110874621-110874643 CGGGGCGGTGGGAGGGTAGCGGG - Intergenic
1114460304 14:22882396-22882418 TAGGGGAGTTGGGGGGTAGCTGG + Intergenic
1114652067 14:24291535-24291557 AGGTGAAGTTTGGGGGCAGCTGG - Exonic
1115498160 14:34027169-34027191 AGGGGAAGGGGGAGGGGAGGGGG + Intronic
1116133303 14:40889192-40889214 AGGGGAAGAAGGAGGGAAGGAGG + Intergenic
1116286242 14:42975613-42975635 AGGAGAAGTGAGAGGGTAGAGGG - Intergenic
1116501938 14:45634470-45634492 AGGGGAAGGGGGAGGGAAGGAGG - Intergenic
1117716498 14:58586960-58586982 AGGGGAGTTTGGAGGGTGGGAGG - Intergenic
1119054764 14:71407837-71407859 AGGGGGAGATGGAGCTTAGCAGG + Intronic
1119068888 14:71560454-71560476 AGGGGGAGTAAGAAGGTAGCAGG + Intronic
1119851835 14:77871741-77871763 AGGGGAGGTCTGAGGGGAGCAGG + Intronic
1120211812 14:81641165-81641187 AGGGGAGGTTGGGGAGAAGCTGG + Intergenic
1122537399 14:102475203-102475225 AAGGCAAGTAGGAGTGTAGCAGG + Intronic
1122846560 14:104503263-104503285 AGGGGAAGGTGAAGGGAAGCTGG - Intronic
1123102060 14:105811026-105811048 AGGTGAAGGTGAAGGGAAGCAGG + Intergenic
1123800866 15:23819145-23819167 AGGAGTAGATGGAGGGTTGCGGG - Intergenic
1124038203 15:26076276-26076298 ATGGGAGGTTGGAAGGTAGGAGG + Intergenic
1124511083 15:30326501-30326523 AGTGGAAGGTGAAGGGGAGCAGG - Intergenic
1124731831 15:32204264-32204286 AGTGGAAGGTGAAGGGGAGCAGG + Intergenic
1125364936 15:38903563-38903585 AGGGGAGGTTGGAAGGGAGGTGG - Intergenic
1126849809 15:52790096-52790118 AGGGGAAGGTGGGGGGTAAGAGG - Intronic
1127018816 15:54721992-54722014 AGGGGGAGTTGGAGGGAAATGGG - Intergenic
1127334199 15:57967531-57967553 AGGGGAAGTTGGAGTTTCCCCGG - Intronic
1128667737 15:69550843-69550865 AGAGGAAGTAGGAGGGCAGTCGG + Intergenic
1129382771 15:75178477-75178499 AGGGGCTGTTGGAGGCTTGCGGG - Intergenic
1129600648 15:76996369-76996391 AGGGGTAGTTGAAGGACAGCTGG - Intronic
1130003023 15:80064365-80064387 AAGGAAAGATGGAGGGTAGATGG - Intronic
1131168852 15:90162194-90162216 AGCAGAAGTTGGAAGGGAGCAGG - Intronic
1131330615 15:91495841-91495863 AGTGTGAGTTGGAGGGTAGGTGG + Intergenic
1134069656 16:11253166-11253188 AGGTGAAGTGGGAGGGAAGGAGG - Intronic
1134351827 16:13444796-13444818 AAGGGAAGATGGAGGGAAGAGGG - Intergenic
1136186366 16:28591062-28591084 AGTGGAAGAGGGAGGGCAGCTGG - Intronic
1137554198 16:49460482-49460504 AGGGGAGGTTTGAGGGAGGCAGG + Intergenic
1137565993 16:49532837-49532859 GGGGGACGTTGGTGGGTACCTGG - Intronic
1137725884 16:50656318-50656340 AGTGGAAGGTGAAGGGGAGCGGG - Intergenic
1138251715 16:55506848-55506870 TGGGGGTGGTGGAGGGTAGCAGG - Intergenic
1138432006 16:56975067-56975089 TGAGGAAGTTGGAGGGTGGGTGG - Intronic
1142246314 16:88971734-88971756 AGGGGCAGCTGGAGAGAAGCAGG - Intronic
1143487792 17:7264047-7264069 TGAGGAGGTTGGAGGGTAGTAGG - Intergenic
1143532415 17:7513036-7513058 AGGTGACGTTGGCGAGTAGCTGG - Exonic
1143532474 17:7513291-7513313 AGGGGAAGTGGGTGAGTAGCTGG - Exonic
1143532490 17:7513375-7513397 GGGTGAAGTTGGCGAGTAGCTGG - Exonic
1143532507 17:7513459-7513481 TGGGGAAGTGGGTGAGTAGCTGG - Exonic
1143855638 17:9846378-9846400 AGCTGAAGTGGGAGGGTTGCTGG + Intronic
1145940092 17:28738772-28738794 AGGGGAAGTCGGGGGATGGCGGG + Intronic
1146261945 17:31427701-31427723 ATGGGAGGCTGGAGGGTAGAGGG + Intronic
1146728636 17:35175412-35175434 AGGGGAGGTGGGTGGGCAGCTGG + Intronic
1146804759 17:35856268-35856290 AGGGGAAGTGGAAGGGAGGCTGG + Intronic
1148713011 17:49695551-49695573 AGGGGAAGGTGGAGGTGAGGAGG - Intergenic
1148835937 17:50465780-50465802 AGGGGAAGTTGGAGGGTAGCTGG + Exonic
1150037253 17:61816787-61816809 TGGGGAAGTGGGCGGGTAGGCGG + Intronic
1150128534 17:62653764-62653786 AGGGGAAGGTGGCCGGTAGAGGG + Intronic
1150466500 17:65397396-65397418 AGGTGAAGCTGGAGGCTTGCTGG - Intergenic
1151182026 17:72336215-72336237 AGGGGAGGGTGGAGGGAAGGAGG - Intergenic
1151230480 17:72681409-72681431 GTGGAAAGTTGGAGGGAAGCAGG + Intronic
1151326229 17:73381137-73381159 AGGGGAAGGTGGAGGCTCCCTGG + Intronic
1151328334 17:73392187-73392209 AGGGGGTGGGGGAGGGTAGCTGG + Intronic
1151498701 17:74474875-74474897 GGGGGAAGTTGGGGGGCAGATGG + Intronic
1151507961 17:74541784-74541806 AGGGGATGGTGGAGGGCACCTGG - Intronic
1152427420 17:80225755-80225777 AGGGGAGGTGGGCGGGGAGCTGG + Intronic
1153359243 18:4174762-4174784 AGGGCCAGTTGGGGGGTGGCAGG - Intronic
1153982206 18:10320149-10320171 AGGGGAAGTGGGAGGAGAGGAGG + Intergenic
1154944287 18:21146608-21146630 AATGGAAGTAGGAGGATAGCAGG - Intergenic
1155702806 18:28768901-28768923 AGGAGAAGTTGTAAGGAAGCGGG + Intergenic
1156316428 18:35972819-35972841 AGGGGAAGCGGGAGGCGAGCGGG + Intronic
1156466890 18:37353444-37353466 AGGGGAGGTTGGTGTGGAGCTGG + Intronic
1156470961 18:37376987-37377009 AGGGGAGGGTGGAGGGGAGAGGG + Intronic
1157241023 18:46009524-46009546 AAGGGAACTTAGAGGGTGGCAGG + Intronic
1157418713 18:47527013-47527035 AGAGTAGTTTGGAGGGTAGCTGG - Intergenic
1159649271 18:70958224-70958246 AGGGGGAGTTGGGGGGTAAGGGG - Intergenic
1160144669 18:76353700-76353722 GGTGGAAGGTGGAGGGGAGCTGG - Intergenic
1160223327 18:76992805-76992827 AGGGCAAGTGGGAGGAGAGCTGG - Intronic
1160353578 18:78206880-78206902 AGGGGAACATGGAGGGCAGGTGG - Intergenic
1160745351 19:708844-708866 CGGGGAGGTGGGAGGGGAGCGGG + Intergenic
1160872163 19:1282456-1282478 AGGGGAGGTGGGAGGGAAGTAGG + Intergenic
1160959887 19:1715728-1715750 AGGGGAAGAGGGAGGGAAGTGGG + Intergenic
1161022358 19:2016054-2016076 AGGGGAGGTGGGAGGGGAGGAGG + Intronic
1161155599 19:2730756-2730778 AGTGGAAGTTGGGGGGTCTCAGG + Intronic
1161155616 19:2730818-2730840 AGTGGAAGTTGGGGGGTCTCAGG + Intronic
1161155635 19:2730880-2730902 AGTGGAAGTTGGGGGGTCTCAGG + Intronic
1161155689 19:2731071-2731093 AGTGGAAGTTGGGGGGTCTCAGG + Intronic
1162234421 19:9296102-9296124 AAGGGAAGTGGGAAGGTAGAAGG + Exonic
1162445362 19:10719225-10719247 AGGGGTGGTAGGAGGGTAGAGGG + Intronic
1162802453 19:13118738-13118760 CGGGGAAGTTGGAGGGTCCGAGG + Intronic
1163455577 19:17404089-17404111 TGTGGCAGGTGGAGGGTAGCGGG + Intronic
1163516275 19:17765793-17765815 AGGAGAAGGTGGAGGGAGGCTGG + Intronic
1163621879 19:18365815-18365837 AGGGGAAGGTGGATGCTGGCGGG + Exonic
1163821183 19:19497509-19497531 AGGGGAAGGAGGAGGGGAACTGG + Intronic
1163834614 19:19565547-19565569 AGGGGTAGTTGGAATGTACCAGG + Intronic
1164270874 19:23670585-23670607 AGGGGAACTTGTAGGGTCCCCGG - Intronic
1164451730 19:28371959-28371981 AGTGGAAGATGGAGGGGAGGTGG - Intergenic
1165122443 19:33569017-33569039 AGGGTAACTTGGTGGGTAGAAGG - Intergenic
1165290249 19:34878013-34878035 ATTGGAAGGTGGAGGGTGGCAGG - Intergenic
1165347699 19:35259142-35259164 AGGGTAAGCTGGAGGGCAGAGGG - Intronic
1166331002 19:42077969-42077991 AGGAAGAGTTGGTGGGTAGCAGG + Intronic
1166631405 19:44410800-44410822 GGGCGTAGTTGGAGAGTAGCTGG - Intergenic
1166737806 19:45096626-45096648 AGGGGCAGTTGGAGCCTGGCTGG + Intronic
1166798914 19:45444137-45444159 GGGGTCAGTTGGAGGGAAGCGGG - Intronic
1166975281 19:46601918-46601940 ATGGGGTGGTGGAGGGTAGCTGG + Intronic
1167077102 19:47256738-47256760 ATGGGAAGCTGGAGGGGCGCTGG + Intronic
1167284149 19:48589309-48589331 AGGGGAGGAGGGAGGGGAGCAGG + Intronic
1167587889 19:50385165-50385187 AGTGGAAATTGGATTGTAGCAGG + Intronic
1167668826 19:50838420-50838442 GGGGGAAGCTGGAGGGGAGGAGG + Intergenic
1167770909 19:51517063-51517085 AGGGCATTTTGGAGGGTAGGAGG - Intergenic
1167994115 19:53388758-53388780 AGGGGAGGTTGGGGAGAAGCTGG + Intronic
925030025 2:643271-643293 AGTGGAAGGTGGAGGGGAACTGG - Intergenic
925522627 2:4764689-4764711 AGGGGCAGTTGGGGGGTGGGGGG + Intergenic
925657337 2:6164303-6164325 AGGGGAAGTTTGAGAGTTGTAGG - Intergenic
925975646 2:9140154-9140176 AGGGGAACTTGCTGGGCAGCTGG + Intergenic
926081756 2:9992812-9992834 ATGGGAAGCTGGAGGTGAGCAGG + Intronic
926207667 2:10845721-10845743 AGGGGCAGTTGGAGGAGAGCTGG + Intergenic
927414128 2:22859001-22859023 AGGGGAAGTGGTAGAGGAGCGGG - Intergenic
927684226 2:25159734-25159756 AGGGGAAGGTGGGGGGTTCCAGG + Intergenic
928027862 2:27754679-27754701 GGAGGAAGTTGGGGGATAGCTGG - Intergenic
928136730 2:28693505-28693527 GGGGGAAGTTGGAGGGTGGGAGG - Intergenic
928425832 2:31177006-31177028 AGGGTAAGCTGGCGGGAAGCTGG - Exonic
928955161 2:36858584-36858606 AGGGGAAGAGGGAGGGAAGTGGG + Intronic
930017214 2:46979184-46979206 AGGGGAGGGTGGAGGGCATCTGG + Intronic
930163691 2:48183086-48183108 AGGTGAAGTTGGAGGGGTACTGG - Intergenic
932083034 2:68732572-68732594 TGGGGAGGCTGGAGGGTAGCTGG + Intronic
932903923 2:75729678-75729700 AGTGGAAGGTGAAGGGGAGCAGG - Intergenic
934107657 2:88710383-88710405 AGGAGCAGTTGGAGGGGAGGAGG + Intronic
934117504 2:88811079-88811101 AGGGGAAGTGGGAGGGTGGTGGG + Intergenic
934494999 2:94789021-94789043 AGGGCACCTTGGAGGGTGGCTGG - Intergenic
934575368 2:95397248-95397270 AGGGGCAGCTGGAGGGAAGTGGG + Intergenic
934706435 2:96484845-96484867 GGTGGAAGGTGGAGGGTAGGAGG - Intergenic
935396340 2:102613441-102613463 AGGGGGAGATGGTGGGTAACAGG - Intergenic
936161106 2:110084815-110084837 AGGGGAAGTGGGAGGGTGGTGGG + Exonic
936183557 2:110286539-110286561 AGGGGAAGTGGGAGGGTGGTGGG - Intergenic
937049255 2:118875243-118875265 AGGAGCAGTTGGAGGGTTGGTGG - Intergenic
937875422 2:126821771-126821793 AATGGAAGTTTGAGGGTAGGAGG + Intergenic
937912179 2:127081085-127081107 GGGGGCTGTTGGAGGGTGGCAGG - Intronic
938108695 2:128550264-128550286 AGGGGAAGATGAAGGGGAGTGGG - Intergenic
938540726 2:132281678-132281700 GGGTGTAGTTGGAGAGTAGCTGG + Intergenic
938541581 2:132287728-132287750 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
939158458 2:138555109-138555131 GGGGGTTGTTGGAGGGTAGGAGG + Intronic
939649709 2:144745673-144745695 TGGGGCAGTTGGAGGAGAGCCGG + Intergenic
940089092 2:149896140-149896162 ATGGGAGGTTGGAGGGTGGGAGG + Intergenic
940474692 2:154148059-154148081 GGGGGAAGGTGGAGGGTGGAGGG - Intronic
941855590 2:170227289-170227311 AGGGGAAGTGGGGGGGTACAGGG + Intronic
941894210 2:170613112-170613134 TGTGAAAGCTGGAGGGTAGCTGG - Intronic
942304139 2:174589412-174589434 TGGGGAAGTTGGAGGCTGCCAGG - Intronic
942730731 2:179058059-179058081 TGGGGAAGGGGGAGGGTTGCAGG + Intergenic
944054319 2:195507549-195507571 AGGATAATTTGGTGGGTAGCAGG + Intergenic
944191630 2:197010018-197010040 AGTGGAAGTGTGAGGGGAGCAGG + Intronic
944284281 2:197931015-197931037 GGGGTCAGTTGGAGGGTGGCAGG + Intronic
944666700 2:201965004-201965026 AGGGGCATTGGGAGGGCAGCTGG - Intergenic
944890132 2:204108926-204108948 AGTGGAAGTGGGAGGGAAACTGG + Intergenic
944911348 2:204313470-204313492 AGGGAAACTTGGAGGGTGGCGGG - Intergenic
945656289 2:212628019-212628041 AGGGGAAGTAGGAAGGCAGCTGG + Intergenic
945838849 2:214864818-214864840 AAGGGTAGTTGGAGGGTGGGGGG + Intergenic
945943627 2:215973503-215973525 TGGGGGAGTTGGAGGATAGCTGG - Intronic
946734394 2:222740052-222740074 AGCGGAAGGTGAAGGGGAGCTGG + Intergenic
947594246 2:231400748-231400770 AGGGGAGGTTGGGGAGAAGCTGG - Exonic
947595386 2:231408382-231408404 AGGGGAGGTTGGGGAGAAGCTGG - Intergenic
948212946 2:236208484-236208506 AGGGCCAGTGGGAGGGTCGCTGG - Intronic
1169266075 20:4168064-4168086 AGAGGGAGTGGGAGGGAAGCTGG - Intronic
1171400302 20:24868851-24868873 AGGGGAAGGTGGGAGGGAGCAGG - Intergenic
1171456631 20:25276146-25276168 CTGGGAACATGGAGGGTAGCAGG + Intronic
1171870449 20:30520604-30520626 GGGAGTAGTTGGAGAGTAGCTGG + Intergenic
1171935885 20:31274531-31274553 AGGGGAGCTTCGAGGGTAACTGG + Intergenic
1172842284 20:37909213-37909235 GAGGGAAGTTGGAGGGTCGCTGG - Intronic
1173761985 20:45570030-45570052 ATGGGAGGTTGGAGGGTAGGAGG + Intronic
1173906244 20:46631874-46631896 AGGGCAAGTTGGGGGGCAGTAGG - Intronic
1174123253 20:48283321-48283343 AGGGGAAGGTGAAAGGGAGCCGG + Intergenic
1174379787 20:50149253-50149275 AGGGAAAGGTGGAGGGTGTCAGG - Intronic
1174568033 20:51481068-51481090 AGGGGAGGATGGAGGGTGGACGG - Intronic
1174648759 20:52106620-52106642 AGGGGAAGTTTGAGGAAAACAGG - Intronic
1175313091 20:58025305-58025327 AGGGGGCGTTGGAGGGGGGCTGG + Intergenic
1175949846 20:62577603-62577625 AAGGGCAGCTGGAGGGCAGCAGG + Intergenic
1176270372 20:64233102-64233124 AGGGGAAGGAGGAGGGAAGAAGG - Intronic
1176306038 21:5123636-5123658 AGGGCAGGTTGGAGGCTGGCTGG - Intronic
1176366521 21:6036190-6036212 AGGGGATGTTTGAGGATAGAGGG + Intergenic
1176515730 21:7781936-7781958 AGGGGAAGTTCGTGGGTGGCCGG - Intergenic
1176611991 21:8991825-8991847 AGGCGAAGTTGGAAAGTAGCTGG - Intergenic
1178150983 21:29793475-29793497 AGGGGAAGGGGCAGGGTAGGGGG - Intronic
1178649758 21:34411948-34411970 AGGGGAAGTTCGTGGGTGGCCGG - Intergenic
1179396300 21:41043451-41043473 GGGGGAAGGTGAAGGGAAGCAGG + Intergenic
1179756996 21:43502355-43502377 AGGGGATGTTTGAGGATAGAGGG - Intergenic
1179851019 21:44138395-44138417 AGGGCAGGTTGGAGGCTGGCTGG + Intronic
1180230408 21:46423803-46423825 AGGGGGAGTGGGAGGGGAGGAGG + Intronic
1180352505 22:11816349-11816371 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1180385750 22:12176008-12176030 GGGCGTAGTTGGAGAGTAGCTGG - Intergenic
1180708522 22:17824233-17824255 AGGGGTAATTTGAGGGTGGCTGG - Intronic
1180745765 22:18087957-18087979 AGGGGAAGCTGCAGGGCAGAGGG - Exonic
1180872496 22:19154577-19154599 AGGGGAAGGGGGAGGGGAGGGGG - Intergenic
1181581787 22:23832780-23832802 TGGGGAGGTGGGAGGGTGGCTGG - Intronic
1181822953 22:25489902-25489924 AGGGAGAAGTGGAGGGTAGCAGG - Intergenic
1181876781 22:25945984-25946006 AGGGGAGGTGGGAGGGGAGGGGG - Intronic
1182074202 22:27483882-27483904 AGGGGAAGATGGAAGGCAGGAGG - Intergenic
1182110701 22:27721194-27721216 GGGGGGTGTTGGGGGGTAGCTGG - Intergenic
1183738501 22:39657128-39657150 GGGGGAAGTTGGAGGGGTCCGGG - Intronic
1184130882 22:42515726-42515748 TGGGGAAGCAGGAGGGGAGCCGG + Intronic
1184141058 22:42577556-42577578 TGGGGAAGCAGGAGGGGAGCCGG + Intergenic
949093634 3:60076-60098 AGTGGAAGGTGAAGGGAAGCTGG - Intergenic
949365951 3:3280588-3280610 AGCGGAAGTTGGGGGTTACCAGG + Intergenic
949507257 3:4739412-4739434 AAGGGGAGTTGCAGGGAAGCAGG + Intronic
949775011 3:7622928-7622950 AGGGGAAAGTGGGGGGTTGCAGG + Intronic
949811560 3:8012177-8012199 AGGATAATTTGGTGGGTAGCGGG - Intergenic
949892213 3:8741808-8741830 CGGGGAAGGTGTAGGATAGCAGG - Intronic
950017709 3:9765931-9765953 AGGAGAGGCTGGAGGGAAGCTGG - Exonic
950260230 3:11538000-11538022 AGGGAAAGGTGGAGGGAAGAGGG + Intronic
950453826 3:13080677-13080699 AGTGGCCGTTGGAGGGTAGGTGG - Intergenic
952268161 3:31806780-31806802 AGAGGAAGTTGGGGGGTGGGGGG + Intronic
952847956 3:37704281-37704303 AGGGGAGGCTGGTGGGGAGCTGG - Intronic
953003185 3:38953253-38953275 ATGGGAAGGTGGAGGGTGGAAGG + Intergenic
953925190 3:46979206-46979228 GCGGGAAGTTAGAGAGTAGCAGG - Intronic
954600192 3:51861485-51861507 AGGGGAACTTGTACTGTAGCAGG - Intergenic
954854533 3:53632303-53632325 AGAGAAAGTTGGAAGCTAGCAGG - Intronic
955655698 3:61242695-61242717 AGGATAATTTGGTGGGTAGCGGG + Intronic
956359544 3:68432181-68432203 AGGGGAGGTTGGGGAGAAGCTGG + Intronic
956915092 3:73862459-73862481 AGGACAACTTGGTGGGTAGCGGG + Intergenic
957726599 3:84073911-84073933 AGGGTAATTTGGTGGGTAGGGGG + Intergenic
960015105 3:112878240-112878262 AGGGCCTGTTGGAGGGTAGGGGG + Intergenic
962709188 3:138071401-138071423 CGGGGAAGTTGGAGGAGAGCCGG - Intronic
963108061 3:141663516-141663538 AGGGTAATTTGGTGGGTAGGGGG + Intergenic
963120067 3:141768876-141768898 AAGGGAAGCTGGAGAGAAGCAGG - Intergenic
964245058 3:154642206-154642228 AGGAGAAGCTGCAGGGGAGCAGG - Intergenic
964794576 3:160483112-160483134 AGTGGAAGGTGAAGGGGAGCTGG - Intronic
965515934 3:169621046-169621068 AAGGGAAATTGGAGAGCAGCTGG - Intronic
965723676 3:171689735-171689757 AGCTGAAGTGGGAGGGTGGCTGG - Intronic
965754336 3:172009955-172009977 AGGGGAAATGGGAGGCCAGCTGG - Intergenic
965830557 3:172782684-172782706 ACTGGAAGGTGGAGGGTAGGAGG - Intronic
966631076 3:182075646-182075668 AGTGGCAGTTGGAAGATAGCTGG + Intergenic
966659066 3:182394028-182394050 CGGGGAAGCTGAAAGGTAGCAGG - Intergenic
966850927 3:184164660-184164682 AGGGCAAGAAGGTGGGTAGCTGG - Intronic
968066180 3:195761055-195761077 GGGTGAAGTTGGAAGGCAGCTGG + Exonic
968922642 4:3530666-3530688 AGGGGCAGCCCGAGGGTAGCTGG + Intronic
969043071 4:4316235-4316257 ATGGGAAGAGGGAGGGTGGCTGG + Intronic
969932138 4:10641160-10641182 AGGGACAGTTGGAGGGAGGCTGG + Intronic
970850258 4:20594504-20594526 AGGAAAAGGTGGAGGGTAGAGGG + Intronic
972197336 4:36670032-36670054 AGGGGTAGTTGGTGGGGAGAAGG + Intergenic
974927731 4:68321855-68321877 AGGGGAAGGTGTTGGGTAGAAGG + Intronic
975106858 4:70577340-70577362 AGGGGAGGCTGGGGGGAAGCCGG + Intergenic
975160738 4:71121206-71121228 AGGGGAGGGGGGAGGGAAGCGGG - Intergenic
975552761 4:75630474-75630496 AGGGGTAGTTGGAGCGGTGCAGG - Exonic
976393922 4:84535334-84535356 AGTGGAAGGTGGAGGGTGGGAGG + Intergenic
976753755 4:88477284-88477306 AGGGGAAGGGGGAGGGGAGGGGG + Intronic
977278186 4:95005552-95005574 AAGGGAAGTGGGAGGGGAGGAGG - Intronic
977974320 4:103245997-103246019 AGGGGAGGTGGGAAGGCAGCAGG + Intergenic
979026815 4:115587910-115587932 AGGGCAAGTTGGGGGGTAGGGGG + Intergenic
982520620 4:156412244-156412266 AAGGAAAGCTGGAAGGTAGCAGG - Intergenic
982834070 4:160100975-160100997 AGTGGGAGTTGGAAGGTAGTGGG - Intergenic
984207078 4:176798284-176798306 AGGGGAACTTGGAGGGCAACTGG - Intergenic
984299074 4:177892067-177892089 AGTGGAAGTGGGAGGGAGGCTGG - Intronic
985706729 5:1405883-1405905 AGGGGAAGCTGGAGGTGAGTCGG - Intronic
985913465 5:2900583-2900605 AGGGGAAGGTGGAAGGGAGAAGG - Intergenic
986681005 5:10232755-10232777 AGGGGAGGCTGGAGGGGAGCAGG + Intronic
987072957 5:14355028-14355050 AGAGGAAGTTGGAAGGTGGGAGG + Intronic
987692897 5:21291730-21291752 AGAGGAAGATGGTGGGCAGCAGG - Intergenic
988082364 5:26430363-26430385 AGTGGAAGTTGGAGGTTTACAGG - Intergenic
988616610 5:32781122-32781144 AGGGGGAGTGGGAGGGTGGGTGG + Intronic
989018752 5:36973832-36973854 AGGGCCTGTTGGAGGGTAGGGGG - Intronic
990461795 5:56037575-56037597 AGGGGAAGAAGGAGAGGAGCAGG + Intergenic
991747402 5:69757996-69758018 AGAGGAAGATGGTGGGCAGCAGG + Intergenic
991750327 5:69797330-69797352 AGAGGAAGATGGTGGGCAGCAGG - Intergenic
991798980 5:70337852-70337874 AGAGGAAGATGGTGGGCAGCAGG + Intergenic
991801900 5:70377131-70377153 AGAGGAAGATGGTGGGCAGCAGG - Intergenic
991826753 5:70633214-70633236 AGAGGAAGATGGTGGGCAGCAGG + Intergenic
991829615 5:70672181-70672203 AGAGGAAGATGGTGGGCAGCAGG - Intergenic
991891338 5:71337279-71337301 AGAGGAAGATGGTGGGCAGCAGG + Intergenic
991936867 5:71810738-71810760 ATGGGGAGTTGGAAGGTAGCAGG + Intergenic
992459694 5:76948938-76948960 ATTGGAAGTTGGAGGGTGGGAGG + Intergenic
994156441 5:96508695-96508717 TGTGGAAGTTGGAGGGTCTCAGG + Intergenic
994674513 5:102804016-102804038 AGGAGAAGTGTGAGGGTTGCAGG + Intronic
996434925 5:123423384-123423406 AGGGGAGGTTGGAGGACAACGGG + Intronic
997709766 5:135994258-135994280 AGCAGATGTTGCAGGGTAGCTGG - Intergenic
997777494 5:136624212-136624234 AGGGTAAGGGGGAGGGGAGCTGG - Intergenic
997854217 5:137358541-137358563 AGGGGAAGGTGGAGGGGAAGGGG + Intronic
997861133 5:137417956-137417978 AGGGCCTGTTGTAGGGTAGCGGG - Intronic
998169887 5:139866460-139866482 ATGGGAAGTTGGAGAGGAGCTGG + Intronic
998739111 5:145178526-145178548 AGGTGAAGGTGGAGGTTAGGGGG + Intergenic
999829530 5:155305616-155305638 AGGGGAAGGAGGGGGGCAGCAGG - Intergenic
1000282342 5:159793083-159793105 ATGGGAAGTGGGAGGGGAGATGG - Intergenic
1000460428 5:161510242-161510264 TGGGGAGGTTGGGGGGGAGCTGG - Intronic
1000725995 5:164771619-164771641 GGGTGAAGATGGAGGGGAGCAGG - Intergenic
1000996451 5:167964058-167964080 GGAGGAAGGTGGAGGGTAGAGGG - Intronic
1001150221 5:169220887-169220909 GGGAGAAGTTGGGGGGTAGTAGG - Intronic
1001327512 5:170739866-170739888 AGTGGAAGGTGAAGGGGAGCTGG - Intergenic
1001772427 5:174306218-174306240 AGGGGAGGTTGGAGGGGTGGAGG + Intergenic
1002459490 5:179365960-179365982 GGAGGAAGGTGGAGGGGAGCTGG - Intergenic
1002671050 5:180867650-180867672 AGGGGAGGTTGGGGAGAAGCTGG - Intergenic
1004373426 6:15072262-15072284 TGGGGATGTTGGAGGGCAGGTGG + Intergenic
1004492380 6:16129123-16129145 AGGGGCAGCTGGCGGGCAGCGGG + Exonic
1006067997 6:31476272-31476294 AAGGGAAGTTGTTGGGCAGCTGG - Intergenic
1006129779 6:31862331-31862353 AGGGGAGTTTGGAGCGAAGCTGG + Intronic
1006168763 6:32081273-32081295 AGGCGAAGATGGAGGGAGGCTGG + Intronic
1006317117 6:33297684-33297706 AGGGGAAGTGGGATGATAGGGGG + Intronic
1006461993 6:34164988-34165010 AAGGGTAGTTGGGGGGTGGCGGG - Intergenic
1009642450 6:66355646-66355668 AGAGGACGTGGGAGGGCAGCAGG - Intergenic
1010256774 6:73767202-73767224 ATGGGAGGGTGGAGGGTAGGAGG - Intronic
1011513096 6:88123077-88123099 AGGTTAATTTGGTGGGTAGCAGG - Intergenic
1012794998 6:103748697-103748719 GTGGGAAGATGGAGGGTAGGAGG - Intergenic
1013306176 6:108848707-108848729 GGGCGAAGTGGGAGGGTGGCCGG + Intronic
1017205105 6:151796414-151796436 AGGGAAAATTGGTGGGTTGCAGG + Intronic
1018149726 6:160926531-160926553 TGGGGATGTTGGAGGGTCCCTGG + Intergenic
1018375031 6:163202166-163202188 AGGGGAAAATGGAGGGAAACTGG + Intronic
1018945657 6:168345729-168345751 GGGGGAAGCTGGGGGGCAGCCGG + Intergenic
1018948455 6:168363369-168363391 AGGGGGAGATGGAGGGGAGGGGG + Intergenic
1019054315 6:169212108-169212130 AGAGGAAGATGAAGGGGAGCTGG + Intergenic
1019113747 6:169739495-169739517 ATGGGAAGTTGGAGAGAACCTGG + Intergenic
1019652946 7:2170401-2170423 AGGGCAAGTGGGAGGGCAGAGGG + Intronic
1021825166 7:24543571-24543593 AGTGGAGGGTGGAGGGTAGGAGG - Intergenic
1021992446 7:26151943-26151965 AGGGCTAGGTGGTGGGTAGCTGG - Intergenic
1022239932 7:28500738-28500760 GGGGGAAGCTGGAGGGAAGATGG + Intronic
1022843589 7:34188934-34188956 AGGGGAATTTGGAGGCCTGCTGG + Intergenic
1024575927 7:50764132-50764154 AGGGGAAGGTGGAAGGCAGCTGG - Intronic
1024936942 7:54720090-54720112 AGAGGAAGGTGAAGGGGAGCAGG - Intergenic
1025028625 7:55537804-55537826 AGTGGAAGTTGGAGGGGAAGTGG - Intronic
1026530069 7:71189530-71189552 AGGGGCAGTTGGAGGGAGGAAGG + Intronic
1026806095 7:73430393-73430415 AGGGGGAGGGGGAGGGGAGCGGG - Intergenic
1026897012 7:74015120-74015142 AAAGGAAGTTGGTGGGTAACTGG - Intergenic
1029498099 7:100908902-100908924 AGGGGAAGTTGAAGGGGAGCTGG - Intergenic
1030131445 7:106205210-106205232 AGGGGAAGCTGGAGGCTGGGCGG - Intergenic
1030345970 7:108433249-108433271 AGGGGTAGTTAGGAGGTAGCTGG - Intronic
1031007835 7:116494856-116494878 AGTGTGAGTTGGAGGGTAGAAGG + Intronic
1031076007 7:117213285-117213307 AAGGGAAGTTGGAAGGGAGTTGG - Intronic
1032747726 7:134804967-134804989 AGGGTAATTTGGTGGGTAGGGGG + Intronic
1033254404 7:139787529-139787551 AGGGGAAGGTGGTGGGCAGCTGG + Intronic
1033773702 7:144582664-144582686 AGGTGCAGCTGGAGGGAAGCAGG - Intronic
1033969818 7:147025412-147025434 AGGGGAAGGGGGAGGGGAGGGGG + Intronic
1034345266 7:150381924-150381946 CCGGGAAGTTGGAGAGGAGCAGG + Intronic
1034486715 7:151369867-151369889 AGGGGTATTTGGATGGGAGCAGG + Intronic
1036279853 8:7391347-7391369 AGGGGCAGGGGGAGGGGAGCTGG + Intergenic
1036341667 8:7920536-7920558 AGGGGCAGGGGGAGGGGAGCTGG - Intergenic
1037689869 8:21172628-21172650 AGGAGAAGTTGCAGGGCAGGGGG + Intergenic
1038143241 8:24868887-24868909 AGGGCAAGTAGGAGGTAAGCAGG - Intergenic
1038286776 8:26212457-26212479 AGGGAACATTGGAGGGGAGCAGG - Intergenic
1038760331 8:30379870-30379892 AGGGGAAGATGGAGAGGAGCTGG + Intergenic
1039477194 8:37845388-37845410 AGGGGAAGGTGGAGGGATGGAGG + Intronic
1039507653 8:38063592-38063614 TGGTGATGTTGGAGGGTGGCAGG - Intergenic
1039912479 8:41835963-41835985 AGGGGGAGAGGCAGGGTAGCCGG + Intronic
1040519194 8:48160459-48160481 AGGGGAACATGGAGGATAGCTGG + Intergenic
1041024011 8:53665899-53665921 TGGGGAAGTGGGAGGGTGGAGGG - Intergenic
1041606058 8:59783607-59783629 GAGAGAAGTAGGAGGGTAGCTGG - Intergenic
1044723616 8:95174256-95174278 GGGGGAAGATGGGGGGTGGCAGG - Intergenic
1045396524 8:101766057-101766079 AGGAGATGTTGGTGGGTTGCGGG - Intronic
1046098295 8:109585722-109585744 AGGGGAGGTAGGAGGGAAGTGGG + Intronic
1046190163 8:110784782-110784804 AGTGGAAGGTGAAGGGGAGCTGG + Intergenic
1049155873 8:141066462-141066484 AGGGGATTTTTGAGGGGAGCTGG - Intergenic
1049192327 8:141295206-141295228 AGGGAAAGCAGGAGGGAAGCTGG + Intronic
1049271113 8:141696763-141696785 TGGGGAAGTTGAGGGGCAGCGGG + Intergenic
1049506354 8:143001791-143001813 ATTGGAGGTTGGAGGGTAGGAGG - Intergenic
1049514239 8:143044981-143045003 AGGTGGTGTTGGAGGGTTGCAGG - Intronic
1049712363 8:144071174-144071196 AGGGGAAGGGGGAGGGGAGGGGG - Intergenic
1049712391 8:144071225-144071247 AGGGGAAGGGGGAGGGGAGGGGG - Intergenic
1049998500 9:1052182-1052204 TGGGGGAGTTGGAGGGGAGCGGG + Intronic
1050199701 9:3131241-3131263 TGAAGAAGTTGGAGAGTAGCAGG - Intergenic
1050643736 9:7696182-7696204 AGGGGGAGTGGGTGGGAAGCGGG - Intergenic
1050748469 9:8906679-8906701 AGAGGAAGGTGGAAGGGAGCAGG - Intronic
1050755662 9:9000237-9000259 ATGGGTACTTGGATGGTAGCAGG - Intronic
1052384542 9:27808015-27808037 AGGGGAAGTTTGAGTGTAAAGGG + Intergenic
1052754364 9:32525558-32525580 AGTGGAAGCTGGAGAGGAGCCGG - Intronic
1052823484 9:33158396-33158418 AGAGGAAGTCTGAGGGTAGCTGG - Intronic
1052947345 9:34179030-34179052 AGGGGAAGGAGGAGGGAAGTAGG + Exonic
1053028651 9:34755059-34755081 AGGGGTAGTTGGAGGGTTGGGGG + Intergenic
1053662123 9:40291333-40291355 AGGGCACCTTGGAGGGTGGCTGG + Intronic
1053912572 9:42921501-42921523 AGGGCACCTTGGAGGGTGGCTGG + Intergenic
1054374250 9:64437573-64437595 AGGGCACCTTGGAGGGTGGCTGG + Intergenic
1054522487 9:66084951-66084973 AGGGCACCTTGGAGGGTGGCTGG - Intergenic
1054947826 9:70814864-70814886 AGGGAAAGAGGGAGGGAAGCAGG - Intronic
1056819307 9:89826121-89826143 GGGAGAAGCTGCAGGGTAGCTGG + Intergenic
1057067896 9:92072570-92072592 TGGGGAAGATGGAGGGTGGGAGG - Intronic
1057505762 9:95632168-95632190 AGGGGAAGTTGCAGTGAGGCTGG + Intergenic
1058108516 9:101003429-101003451 GGGGGAGGGGGGAGGGTAGCAGG + Intergenic
1058850997 9:109012722-109012744 AGGGGAAGGGGTAGGGTGGCCGG + Intronic
1058944330 9:109841971-109841993 AGGGGAAGTTGGAGGGATAGAGG + Intronic
1060046676 9:120347020-120347042 ATGGGAGGGTGGAGGGTAGGAGG - Intergenic
1060277623 9:122193862-122193884 AGGGGAGCTGGGAGGGAAGCGGG + Intronic
1060817402 9:126642425-126642447 AGGGGAAGTGGGAGTGTGGGTGG - Intronic
1060835267 9:126751074-126751096 AGGGGAAGTTGGTGTATAGTGGG - Intergenic
1203698769 Un_GL000214v1:118912-118934 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203700620 Un_GL000214v1:131202-131224 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203701584 Un_GL000214v1:137512-137534 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203480421 Un_GL000224v1:6096-6118 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203481388 Un_GL000224v1:12424-12446 GGGCGTAGTTGGAGCGTAGCTGG + Intergenic
1203482352 Un_GL000224v1:18733-18755 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203548786 Un_KI270743v1:151724-151746 GGGCGAGGTTGGAGAGTAGCTGG + Intergenic
1203568252 Un_KI270744v1:109475-109497 GGGGGTGGTTGGAGAGTAGCTGG + Intergenic
1203568325 Un_KI270744v1:109910-109932 GGGGGCGGTTGGAGAGTAGCTGG + Intergenic
1203568410 Un_KI270744v1:110486-110508 GGGGGTGGTTGGAGAGTAGCTGG + Intergenic
1203568488 Un_KI270744v1:110924-110946 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1203570010 Un_KI270744v1:121447-121469 GGGCGTAGTTGGAGAGTAGCTGG + Intergenic
1185564869 X:1087400-1087422 AGGAGATGTTGGAGGCTGGCAGG + Intergenic
1185576308 X:1175478-1175500 AGGGGAAGTGGGGGAGAAGCTGG - Intergenic
1187376948 X:18764033-18764055 GGGAGAAGTAGGAGGGTAGTAGG + Intronic
1187833952 X:23411869-23411891 ATGGGTAGTGGGAGGGTGGCGGG + Intergenic
1187974704 X:24693724-24693746 AGGGGAAGCCGGAGGAGAGCAGG - Intergenic
1188004043 X:25005322-25005344 AAGGGAAGGTGGAGGGTGGGAGG + Intronic
1188272544 X:28158440-28158462 AGGTGAAGTTGGAGAGGAGCTGG - Intergenic
1188796698 X:34475713-34475735 ACTTGAAGTTGGAGGGTAGGAGG - Intergenic
1189110541 X:38285923-38285945 AGGGGAAGTGGAAGGGGAGGTGG - Exonic
1189194144 X:39138253-39138275 AGGATAATTTGGTGGGTAGCAGG + Intergenic
1189578403 X:42380168-42380190 AGGGGAAGTTGTAGGATTGGGGG + Intergenic
1191612770 X:63134797-63134819 GGGGGAAGTTGGCGGGGAGGGGG - Intergenic
1191623527 X:63244129-63244151 GGGGGAAGTTGGCGGGGAGGGGG + Intergenic
1192165167 X:68823503-68823525 AGGGGCAGCTGGAGGGTGGTGGG + Intergenic
1192175174 X:68880819-68880841 AGGGGGAGCTGGAAGGTGGCTGG - Intergenic
1192202956 X:69078512-69078534 AGAGGAGGGTGGAGGGCAGCTGG - Intergenic
1192594000 X:72387360-72387382 AGGGAAAGATGGAGGCCAGCAGG + Intronic
1194478274 X:94388101-94388123 TGGGGGAAGTGGAGGGTAGCAGG + Intergenic
1194549601 X:95280042-95280064 ATCGGAAGGTGGAGGGTAGAAGG + Intergenic
1194950221 X:100116814-100116836 AGGGGAAGGTGGAGGGTGAGAGG + Intergenic
1195967142 X:110439064-110439086 AGGGGAAGAGGGTAGGTAGCAGG + Intronic
1197638091 X:128939142-128939164 AGGGGAAAGCGGAGGGGAGCAGG - Intergenic
1197798974 X:130329028-130329050 AGGGGAAGAAGGAGGGTATTTGG + Intergenic
1198564060 X:137885199-137885221 ACTGGAAGGTGGAGGGTAGCAGG + Intergenic
1198984545 X:142434312-142434334 AGGGCCTGTTGGAGGGTAGGGGG + Intergenic
1198986670 X:142462698-142462720 AGGGGCAGGTGAAGGGGAGCTGG - Intergenic
1200002057 X:153067207-153067229 ACGGGAAGATGGAGAGTGGCAGG + Intergenic
1200005676 X:153082818-153082840 ACGGGAAGATGGAGAGTGGCAGG - Intergenic
1200094749 X:153652075-153652097 AAGGGCAGCTGGAGGGTGGCGGG + Intergenic
1200251396 X:154556132-154556154 AGGGGACAGTGGAGGGGAGCTGG - Intronic
1200266371 X:154648284-154648306 AGGGGACAGTGGAGGGGAGCTGG + Intergenic
1200802250 Y:7397601-7397623 AGGGGAAGATGGGGGTTAGATGG - Intergenic