ID: 1148835938

View in Genome Browser
Species Human (GRCh38)
Location 17:50465789-50465811
Sequence TGGAGGGTAGCTGGTTCAAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148835933_1148835938 -2 Left 1148835933 17:50465768-50465790 CCAGGCTGTCGAAGGGGAAGTTG 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1148835938 17:50465789-50465811 TGGAGGGTAGCTGGTTCAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 143
1148835926_1148835938 27 Left 1148835926 17:50465739-50465761 CCAGGGGTTATTGGTAAGGGCGA 0: 1
1: 0
2: 0
3: 1
4: 83
Right 1148835938 17:50465789-50465811 TGGAGGGTAGCTGGTTCAAGCGG 0: 1
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148835938 Original CRISPR TGGAGGGTAGCTGGTTCAAG CGG Exonic
900157926 1:1211008-1211030 GTGAGGGTAGCGGGGTCAAGTGG - Intergenic
900544803 1:3222588-3222610 TGCATGGTAGCTGGTGCATGAGG - Intronic
901038903 1:6352397-6352419 TGGAGGCTGGCTGGATCCAGCGG - Intronic
903691676 1:25178508-25178530 TGGGAGGTAGCTGGGTCATGAGG - Intergenic
903753824 1:25647121-25647143 TGGAGGGTTGCTGGGACCAGTGG + Intronic
903955297 1:27021421-27021443 TGGAGTCTAGCTGGTAAAAGAGG - Intergenic
905042419 1:34971020-34971042 TGGAAGGTATCTGGATCACGGGG + Intergenic
906641556 1:47443995-47444017 GGGAGGGTTGCTAGTTGAAGGGG - Intergenic
911828778 1:102523631-102523653 GGGATGGTACCAGGTTCAAGAGG - Intergenic
912283888 1:108347585-108347607 AGGAGGGTTGCTGGATCAAATGG + Intergenic
914422761 1:147544317-147544339 TGGAGGTTGGCTGGGGCAAGGGG - Intronic
918866785 1:189910501-189910523 AAGATGGTACCTGGTTCAAGAGG - Intergenic
919331732 1:196180930-196180952 TGGAGGCTAGCTTGTTGTAGGGG + Intergenic
920813013 1:209304752-209304774 TGGAGGGTAGCAGATTGATGTGG + Intergenic
1066345346 10:34579807-34579829 TGGAGAGTGGGTGGATCAAGAGG - Intronic
1066654441 10:37685395-37685417 TGGAGGGTAGCTAGTGGGAGCGG - Intergenic
1069793987 10:71040848-71040870 GGGAGGGGAGCTGGTACAGGCGG - Intergenic
1069817369 10:71206994-71207016 GGGAGGGGAGCTGGGTCGAGTGG - Intergenic
1071506272 10:86233713-86233735 TGGAGGGAAGCAGGTTAGAGAGG - Intronic
1074935058 10:118170008-118170030 TGGAAAGTAGCTTGGTCAAGTGG + Intergenic
1078759263 11:14238649-14238671 TGGAGGGAAGCGGGTTCATGTGG - Intronic
1080505757 11:32911567-32911589 TGGAAGGTAACTGGCTCATGGGG + Intronic
1082668491 11:56005118-56005140 TCCAGGGTAGCAGGGTCAAGTGG - Intergenic
1084211697 11:67627257-67627279 TGGAGGATGGCTGGATCCAGGGG - Intergenic
1086775254 11:90823093-90823115 TGGGTTGTAGCTGGATCAAGAGG - Intergenic
1088960441 11:114658505-114658527 GGGAGGGTAGCTGCCTCAAAGGG + Intergenic
1090908710 11:131099392-131099414 TGGAGGGTAGATGGTGGTAGAGG + Intergenic
1091447384 12:551781-551803 GGGACGGGAGCTGGTTCAGGAGG + Intronic
1092514163 12:9190548-9190570 TGGAGGGTAGGTGGAGAAAGAGG + Intronic
1095581966 12:43810534-43810556 TGGTGGGAAGATGGTGCAAGGGG + Intergenic
1100111927 12:91256245-91256267 GGGAAGGTACCAGGTTCAAGAGG + Intergenic
1100123300 12:91394298-91394320 TGGAGGGAAACTGGTTCAACTGG + Intergenic
1100916697 12:99431907-99431929 TAGAGGGTATTTGGGTCAAGAGG + Intronic
1101750880 12:107581426-107581448 TGGAGGCTCCCTGGTTGAAGTGG + Intronic
1105330982 13:19414973-19414995 TGGAGGCCTGCTGGTTCATGTGG + Intergenic
1106778852 13:33035438-33035460 TGGAGAGTAGCTCTTTCATGAGG + Intronic
1107716169 13:43201737-43201759 GGGATGGTACCAGGTTCAAGAGG + Intergenic
1110130490 13:72002852-72002874 TGGAAGGTAGTTGGATCATGGGG - Intergenic
1112313317 13:98339406-98339428 TGGGAGGTAGCTGGATCATGGGG - Intronic
1112708378 13:102098785-102098807 TGGAGGTTACCTGGTTGCAGGGG - Intronic
1114226031 14:20739790-20739812 TGCAGGGAAGCTGCTCCAAGTGG - Intronic
1114647197 14:24262400-24262422 TGGAGGGTTTCTGGGTCAACTGG - Intronic
1117860559 14:60088077-60088099 TGGATGGCACCAGGTTCAAGAGG - Intergenic
1118160344 14:63282890-63282912 TGCAGGGTAACTGTTTGAAGGGG + Intronic
1119127671 14:72142805-72142827 TGAAGGGCAGATGGTTTAAGGGG + Intronic
1119898505 14:78240636-78240658 AGGAAGGTACCAGGTTCAAGAGG - Intergenic
1121197889 14:92091070-92091092 TGGAGGCTAGCTGGGTGCAGTGG - Intronic
1121551559 14:94806620-94806642 TGCAGGTAACCTGGTTCAAGAGG + Intergenic
1121833944 14:97075463-97075485 TGGAGGGTAGAGGGTTGAGGAGG - Intergenic
1124434521 15:29635892-29635914 TGGAAGGGACCTGGCTCAAGAGG - Intergenic
1127272789 15:57416159-57416181 AAGAGGGTGGCTGCTTCAAGGGG - Intronic
1129879711 15:78998646-78998668 TGGAAGGCAGCTGGTTCCTGGGG + Intronic
1140779780 16:78284148-78284170 TGTAGGGTCACTGGTTTAAGGGG + Intronic
1141624946 16:85256213-85256235 TGGAGGGTGGGAGCTTCAAGTGG + Intergenic
1145770294 17:27487939-27487961 TGGAAGGTGGCTGGGTCATGGGG - Intronic
1146051850 17:29560452-29560474 TGGAGGGCAGCTGGTGGTAGCGG + Intergenic
1148835938 17:50465789-50465811 TGGAGGGTAGCTGGTTCAAGCGG + Exonic
1149023147 17:51993435-51993457 TGAAGGATAGTTGGTTCCAGTGG - Intronic
1149550210 17:57534221-57534243 TGCAAGGTAACTGGTTAAAGCGG + Intronic
1152328923 17:79659328-79659350 CAGAGGGTATCTGGGTCAAGCGG + Intergenic
1153001093 18:456069-456091 GGGAGGCTGGCTGGTTTAAGAGG + Intronic
1154087547 18:11322219-11322241 TGGAGGGTAGTTGAATCATGGGG - Intergenic
1156471548 18:37380197-37380219 GGGATGGCAGCTGGTCCAAGAGG - Intronic
1160080239 18:75719740-75719762 TGGAAGGTAGTTGGATCATGGGG - Intergenic
1160837349 19:1131191-1131213 TGGAGGGTGGGTGGGTCATGTGG - Intronic
1162212219 19:9101358-9101380 TGGAAGGTAGATAGTTCAGGAGG - Intergenic
1163026548 19:14516194-14516216 TAGATGGAAGCTGGCTCAAGAGG + Intronic
1166975788 19:46604272-46604294 TGGGGGGCAGGTGGATCAAGAGG + Intronic
1167271494 19:48509020-48509042 TGGAGTGGAGCTGGTCCCAGGGG - Intronic
1167363652 19:49043692-49043714 TGGGGGGCATCTGGGTCAAGTGG + Intergenic
1167366125 19:49055871-49055893 TGGGGGGCATCTGGGTCAAGTGG - Exonic
925760711 2:7181872-7181894 GGGAGGGGACCAGGTTCAAGAGG + Intergenic
926048038 2:9724584-9724606 TGAAGGGGAGGGGGTTCAAGAGG - Intergenic
926136880 2:10342761-10342783 TGGAGGGCAGCTGGCCCAACCGG - Intronic
926166192 2:10523186-10523208 TGGAGGGCAGCAGCTACAAGGGG + Intergenic
927167028 2:20333819-20333841 TGGAGGGTGACTGGATCATGGGG + Intronic
928176971 2:29040882-29040904 GGAAGGGTATCTGGTTCAAGAGG - Intronic
930691909 2:54373220-54373242 TGGAGCGTGGCTGGTTGGAGAGG - Intronic
932083036 2:68732581-68732603 TGGAGGGTAGCTGGGTAGACTGG + Intronic
934084941 2:88502206-88502228 GGGAGGGTGGTGGGTTCAAGTGG - Intergenic
940835767 2:158519807-158519829 TGGAGGGGAACTGGATGAAGAGG - Intronic
940839709 2:158565943-158565965 TGCTGGGTAGCTGGCTCAAGAGG - Intronic
943542776 2:189238799-189238821 TGGAGAGTAGTTGGATCATGTGG - Intergenic
943759426 2:191592311-191592333 GGGAAGGTACCAGGTTCAAGAGG - Intergenic
946361452 2:219221345-219221367 TGGAGGGCAGCTGTTTCAGATGG - Intronic
947185864 2:227454733-227454755 AGGAGGCTACCTGGTCCAAGAGG + Intergenic
1170414006 20:16120866-16120888 TGGAAGGCACCAGGTTCAAGAGG - Intergenic
1172792223 20:37513631-37513653 TGGAGGGTTGCTGGGTAAAATGG + Intronic
1175532011 20:59680203-59680225 GGGAAGGTACCAGGTTCAAGAGG + Intronic
1180563903 22:16646886-16646908 TGGAGGCCTGCTGGTTCATGTGG - Intergenic
1183429716 22:37758168-37758190 TGGAGGGGCGCTGGGGCAAGGGG - Intronic
950484999 3:13267953-13267975 TGGAGGAGAGCTGGTTAAGGGGG - Intergenic
951727525 3:25776635-25776657 TGGAGAGTAGCAGGTTTTAGGGG - Intronic
953020937 3:39112624-39112646 TGGTGGGTCTCTGGTTCCAGTGG - Intronic
954285272 3:49614800-49614822 TGGAGACTAGCTGGTCCCAGAGG + Intronic
957943621 3:87036375-87036397 GGGAAGGTACCAGGTTCAAGAGG + Intergenic
958644539 3:96852647-96852669 TGGAGGGCAACAGGTTGAAGGGG - Intronic
960732608 3:120743089-120743111 TGGAGGGCAGCTGGGTCCGGAGG + Intronic
963261058 3:143191340-143191362 TGGAGGATACCATGTTCAAGTGG - Intergenic
966842013 3:184097531-184097553 TGGAAGGAAGCTGGTTCCACAGG + Intronic
969211354 4:5689930-5689952 TGGAGAGAAGCTGGTGCAGGAGG - Intronic
969723874 4:8907863-8907885 AGGAGGGCAGCTGCTTCATGTGG + Intergenic
971652157 4:29292216-29292238 TGGAGGGTAGCTTAGACAAGAGG + Intergenic
973608090 4:52607629-52607651 TGGAAGGTAACTGGATCACGGGG + Intronic
975483572 4:74909241-74909263 TGGAGGGTTGCTAGTTCCTGAGG + Intergenic
979931977 4:126642339-126642361 GGGAAGGTACCAGGTTCAAGAGG - Intergenic
980775339 4:137429753-137429775 TGGGGGGTATCTGGATCATGGGG + Intergenic
980830801 4:138127689-138127711 TGGAAGGTAGCTGGATCATGGGG + Intergenic
983693767 4:170503789-170503811 TGGGAGGTAATTGGTTCAAGGGG - Intergenic
983917856 4:173311687-173311709 TGGATGGTGACTGGTTCATGGGG - Intronic
985096172 4:186415132-186415154 TGGGGGGTGACTGGTTCATGGGG + Intergenic
987373771 5:17216945-17216967 AGAAGGGTAGCTGGTGCCAGGGG + Intronic
990976194 5:61564002-61564024 TGGAGGGTGACTGGATCATGGGG - Intergenic
993585484 5:89722299-89722321 TGGAGTGAAGCTGGCTCAAAAGG - Intergenic
993953887 5:94208780-94208802 TGGAGCATAGCTTGTCCAAGAGG + Intronic
995620034 5:114015287-114015309 TGGGAGGTAGCTGAGTCAAGGGG + Intergenic
998719391 5:144927359-144927381 TGGTGTGAAGCTGGTTCCAGTGG + Intergenic
1003600691 6:7514454-7514476 GGGAAGGTACCAGGTTCAAGAGG + Intergenic
1003942599 6:11044093-11044115 CCGAGGGTAGCGGGTTCCAGCGG + Intronic
1005270262 6:24156180-24156202 TGGAGTGGAGCTGGCTGAAGAGG + Intergenic
1006150591 6:31984996-31985018 CGGAGAGTAGCTGGTGGAAGTGG + Intronic
1006156892 6:32017734-32017756 CGGAGAGTAGCTGGTGGAAGTGG + Intronic
1010947073 6:81987394-81987416 TGGAGGGTAGTTGAATCATGGGG + Intergenic
1011626876 6:89290375-89290397 CTGAGGGTGGCTGTTTCAAGGGG - Intronic
1012256674 6:97040748-97040770 TGGAGGGTAATTGGATCATGGGG + Intronic
1014281359 6:119445634-119445656 GGGATGGTATCAGGTTCAAGAGG - Intergenic
1017706766 6:157131099-157131121 TGGTGGGTAGATGATTCAAATGG - Intronic
1020150554 7:5678683-5678705 TGGAGGGTAGCAGGCCCAGGAGG - Intronic
1020557414 7:9688313-9688335 TGGAAGGTAACTGGTTCATAGGG + Intergenic
1022175937 7:27871793-27871815 TGAAGGGTATATGGTTCAAGTGG + Intronic
1023203098 7:37720031-37720053 TGGAGGGTTACTGGTCAAAGAGG + Intronic
1028094293 7:86741182-86741204 TGGATGGTACTAGGTTCAAGAGG + Intronic
1029692397 7:102191014-102191036 TGGAAGTGAGATGGTTCAAGAGG - Intronic
1029871992 7:103704096-103704118 TGAAAGGTAGTTGGTTCCAGTGG + Intronic
1030619614 7:111774653-111774675 AGGAGGGTATGTGGTACAAGTGG + Intronic
1031991922 7:128203877-128203899 TGGAGGGTTGCTGGTTTGGGAGG + Intergenic
1035917871 8:3644647-3644669 AAGAGGGCAGCAGGTTCAAGTGG + Intronic
1038982256 8:32772866-32772888 TGGAAGGTACCTGGTTACAGGGG - Intergenic
1039615375 8:38951096-38951118 TGGGGGGCAGCTGGTGCCAGTGG + Intronic
1040655865 8:49506756-49506778 TGGAGGGTAGCTGGAACACAGGG - Intergenic
1043280147 8:78453838-78453860 TGGAGGGTACCTGGGCCATGTGG - Intergenic
1043758443 8:84032603-84032625 TGGAGTGTAGCTTGTTCAGCTGG - Intergenic
1049715838 8:144091094-144091116 TGGAGGCTTGCTGGGTGAAGTGG - Intergenic
1055033028 9:71789868-71789890 TGGAGGGTAGCTGGTACTACAGG + Intronic
1055535070 9:77232780-77232802 TGGGAGGTAACTGGATCAAGAGG - Intronic
1059749251 9:117232420-117232442 TGGAGGGCAGCTGGTTCCTACGG - Intronic
1059755323 9:117288306-117288328 TGGATGGTAGCAGGTTCCAGTGG + Intronic
1060058035 9:120432782-120432804 AGGAGGGCAGCTGGTGCCAGAGG + Intronic
1189523229 X:41792123-41792145 GTTAGGGAAGCTGGTTCAAGTGG + Intronic
1189694309 X:43647978-43648000 AGGAGGATTGCTGGGTCAAGGGG + Intergenic
1197614772 X:128679093-128679115 TGGATGGCACCAGGTTCAAGAGG + Intergenic
1198480425 X:137035046-137035068 AGGAGGTTAGCTGGTTAAACTGG + Intergenic