ID: 1148836617

View in Genome Browser
Species Human (GRCh38)
Location 17:50469038-50469060
Sequence CCTCATGCACGGTAGCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148836617_1148836626 -9 Left 1148836617 17:50469038-50469060 CCAGCCGGCTACCGTGCATGAGG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1148836626 17:50469052-50469074 TGCATGAGGGGGTGGGACCGTGG 0: 1
1: 0
2: 2
3: 18
4: 255
1148836617_1148836632 19 Left 1148836617 17:50469038-50469060 CCAGCCGGCTACCGTGCATGAGG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1148836632 17:50469080-50469102 GAGCCCCGAGCCCTGAGCCCCGG 0: 1
1: 0
2: 9
3: 66
4: 474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148836617 Original CRISPR CCTCATGCACGGTAGCCGGC TGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
902722456 1:18313107-18313129 GGTCATGCACGGTACCCGGCGGG - Intronic
906152200 1:43594097-43594119 CCCCATGCACGGTACAGGGCTGG - Intronic
1062826204 10:570755-570777 CCTCATGCAAGGTAGTGTGCTGG - Intronic
1064205852 10:13322844-13322866 CCTCATGCACGGGACCTGCCCGG - Exonic
1072679962 10:97499163-97499185 CCCCATGCACCGGAGGCGGCGGG - Exonic
1079084265 11:17433925-17433947 CCTCCTGCACCGTTTCCGGCAGG + Intronic
1084173473 11:67411473-67411495 TCTCAGGCACTGTAGCGGGCAGG + Intronic
1084520157 11:69657897-69657919 CTGCATGCAGGGTAGCCGGAGGG - Intronic
1115147160 14:30239112-30239134 CTTCATGCACAGTGGCCTGCTGG - Intergenic
1132513178 16:353863-353885 CCTCATGCTCTGTGGCCTGCAGG - Intergenic
1142340630 16:89520009-89520031 CCTCGTGGACGGCAGCCTGCAGG - Intronic
1144250969 17:13416279-13416301 GCTCATGCACAGGAGCCGACTGG + Intergenic
1148836617 17:50469038-50469060 CCTCATGCACGGTAGCCGGCTGG - Intronic
1160590532 18:79942113-79942135 CCTCATGCGGGGAATCCGGCTGG + Intronic
1160878282 19:1308055-1308077 CCTCCTGCACGGTCGCCTGGTGG + Intergenic
1161040143 19:2106146-2106168 CCTCCTGCACGGCAGCAGGCGGG + Intronic
1161580632 19:5078800-5078822 CACCATGCATGGTAGCAGGCGGG + Intronic
1163233557 19:16018983-16019005 CCACCTGCAGGGTAGCCAGCTGG - Intergenic
938931190 2:136088173-136088195 GCTCAGGCACGGTGGGCGGCAGG + Intergenic
945300886 2:208215429-208215451 CCGCATGCACGGTGGCCTGCTGG + Intergenic
947794688 2:232886908-232886930 CCTCAAGCAGGGTAGCCAGGGGG - Intronic
1172275506 20:33676932-33676954 CCTCGTCCACGGGAGCCCGCAGG + Exonic
1176295430 21:5069606-5069628 GCTCATGCACGGTGGCGGGGGGG + Intergenic
1179615764 21:42582271-42582293 CCTCAGGGATGGCAGCCGGCAGG - Intergenic
1179861620 21:44192518-44192540 GCTCATGCACGGTGGCGGGGGGG - Intergenic
952447195 3:33392861-33392883 CATCATCCACTGGAGCCGGCAGG - Intronic
956060080 3:65340414-65340436 CCTCATGCAGGCAAGCAGGCTGG - Intergenic
958673327 3:97232844-97232866 CTTCATGCACAGTGGCCTGCTGG + Intronic
961376936 3:126473493-126473515 CCTCATGCCTGGAAGCAGGCGGG + Intronic
965181902 3:165414926-165414948 CCACATGCACAGTTGCCAGCAGG + Intergenic
967890589 3:194361647-194361669 CCACAAACACGGTAGCCTGCCGG + Intronic
969636929 4:8374702-8374724 CCTCATGCCAGGCAGCCTGCCGG - Intronic
986903751 5:12468351-12468373 ACACATGCACTGTAGCTGGCAGG + Intergenic
988623575 5:32847829-32847851 CCAAATGCAGTGTAGCCGGCAGG - Intergenic
992086462 5:73282443-73282465 CCTCCTGCAGGGTGGCCAGCTGG - Intergenic
998539249 5:142964753-142964775 TCTCTTGCACGGTAGCCTGTAGG + Intronic
1019217653 6:170454002-170454024 CCTGCTGCACGGTAGGCGGGAGG + Intergenic
1024735811 7:52303063-52303085 GCTCATGCACGGTGGGCTGCAGG + Intergenic
1043053375 8:75408015-75408037 CCTCCTGCCCGGCAGCCGCCGGG - Intronic
1057178490 9:93016271-93016293 CCTCCTGCACCGGAGCCGGGGGG + Intronic
1057455019 9:95200179-95200201 GTTCATGCACGGTAGCAGTCAGG + Intronic
1062052804 9:134456222-134456244 CCTCATGCACCGTGGCCCTCCGG + Intergenic
1062060308 9:134491936-134491958 CCTCCTGCACCGTGGCCGGAGGG - Intergenic
1192118541 X:68433675-68433697 CCTGGTGCAAGGGAGCCGGCCGG + Exonic
1192236168 X:69297499-69297521 CCTCATGCATGGGAGCAGGGTGG + Intergenic
1194133707 X:90112556-90112578 CCGCTTGCACCGTAGCCCGCGGG - Intergenic
1200479489 Y:3682668-3682690 CCGCTTGCACTGTAGCCCGCGGG - Intergenic