ID: 1148838169

View in Genome Browser
Species Human (GRCh38)
Location 17:50477500-50477522
Sequence CCGCGCCCGGCTTCTGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148838156_1148838169 24 Left 1148838156 17:50477453-50477475 CCGCCCGCATCGGCCTCCCAAAG 0: 110
1: 40795
2: 125636
3: 197764
4: 146331
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1148838157_1148838169 21 Left 1148838157 17:50477456-50477478 CCCGCATCGGCCTCCCAAAGTGC 0: 366
1: 88627
2: 228377
3: 238400
4: 154794
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1148838164_1148838169 7 Left 1148838164 17:50477470-50477492 CCAAAGTGCTGGGATTACAGGAG 0: 5428
1: 199502
2: 273806
3: 196586
4: 162484
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1148838161_1148838169 11 Left 1148838161 17:50477466-50477488 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1148838163_1148838169 8 Left 1148838163 17:50477469-50477491 CCCAAAGTGCTGGGATTACAGGA 0: 6574
1: 298330
2: 272362
3: 154692
4: 139673
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160
1148838158_1148838169 20 Left 1148838158 17:50477457-50477479 CCGCATCGGCCTCCCAAAGTGCT 0: 463
1: 92780
2: 190926
3: 137466
4: 71065
Right 1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148838169 Original CRISPR CCGCGCCCGGCTTCTGCCCT GGG Intergenic
900196464 1:1378690-1378712 TCGCACCTGGCCTCTGCCCTCGG + Intergenic
900353171 1:2246930-2246952 CCGTGCCCGGCCTGTGCCCATGG - Intronic
900467095 1:2831146-2831168 CCTGCCCGGGCTTCTGCCCTTGG + Intergenic
900912725 1:5613163-5613185 CTGCTCCCAGCTTCTTCCCTGGG - Intergenic
902468317 1:16631366-16631388 GCTCACCCGGCCTCTGCCCTGGG - Intergenic
903587287 1:24425823-24425845 CCACCCCCTGCTTCTGCCTTCGG + Intronic
904835708 1:33334375-33334397 CTGCGCCCGGCTTTTACCGTGGG + Intronic
905986731 1:42291932-42291954 CCCCATCCGGCTCCTGCCCTCGG - Intronic
907012668 1:50978051-50978073 CCGCTCCCGCCTCCTGCCCGCGG - Intergenic
907336367 1:53702426-53702448 CCTCCCCCGGCATCTGCCCCCGG + Intronic
911211320 1:95141400-95141422 CCGTGCCCACCTTCTGCTCTAGG + Intronic
913191747 1:116418759-116418781 GCGCGCCCGGCTGCGGCCCCAGG + Intergenic
915359700 1:155278394-155278416 CCGCCCCCGCCTTCAGCACTAGG - Intronic
916107206 1:161440970-161440992 ACGCGCCCGGCCCCTGCCGTCGG - Intergenic
916108793 1:161448388-161448410 ACGCGCCCGGCCCCTGCCGTCGG - Intergenic
916110381 1:161455769-161455791 ACGCGCCCGGCCCCTGCCGTCGG - Intergenic
916111966 1:161463179-161463201 ACGCGCCCGGCCCCTGCCGTCGG - Intergenic
916113553 1:161470560-161470582 ACGCGCCCGGCCCCTGCCGTCGG - Intergenic
919919454 1:202159620-202159642 CCGAGACTGCCTTCTGCCCTGGG - Intronic
922842046 1:228650517-228650539 CCTCGCACAGCTTCTGCCCGTGG - Intergenic
1064251617 10:13710484-13710506 CTGCCTCCAGCTTCTGCCCTTGG + Intronic
1065600224 10:27359998-27360020 CCGGGCCTGGCATCTGGCCTTGG + Intergenic
1065784349 10:29199548-29199570 CCCTGCCCGGCTTCTCCACTGGG - Intergenic
1065945142 10:30599345-30599367 CCCTGCCCTGCTTCTGCCCACGG + Intergenic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1075289562 10:121216706-121216728 CCCAGCCCCTCTTCTGCCCTGGG - Intergenic
1076791564 10:132779447-132779469 CCCTGCCAGCCTTCTGCCCTTGG - Intronic
1076804874 10:132850321-132850343 CCGCGCCCGGCTCCTGGGCCTGG - Exonic
1077076942 11:706252-706274 CCGCGCTCGGCCTGTCCCCTCGG - Exonic
1077152162 11:1077302-1077324 CCAGGCCCAGCTCCTGCCCTGGG - Intergenic
1077981120 11:7301888-7301910 CCCCTCCAGGCTTCTGCCCCAGG - Intronic
1079431031 11:20388167-20388189 CAGCGCCTGGCCTCTGCCCTAGG + Intronic
1079535991 11:21516025-21516047 CCACACATGGCTTCTGCCCTCGG - Intronic
1081531601 11:43964152-43964174 CCGCGCCTGGCCACAGCCCTAGG - Intergenic
1082801075 11:57415198-57415220 CCGGGCCCACCTTCTACCCTTGG + Intronic
1083551042 11:63590437-63590459 CCCAGCCGGGCATCTGCCCTTGG + Intronic
1083747182 11:64742993-64743015 CCCCGCCCCGTTTCTGCCCGCGG - Intronic
1084611148 11:70203733-70203755 CCGCGCCCACCTTCTTCCCCAGG - Exonic
1084887998 11:72223382-72223404 CCGCGTCCCCCTTCCGCCCTCGG + Intergenic
1086351179 11:85944103-85944125 CCGCCAAGGGCTTCTGCCCTGGG - Intergenic
1090369432 11:126238069-126238091 CCGCACCCGGCCTCTTCCATTGG - Intronic
1090952229 11:131483807-131483829 CAGAGCCTGTCTTCTGCCCTTGG + Intronic
1092532807 12:9359700-9359722 TCGCCCCCGGGTTCTGCCCAGGG + Intergenic
1094288185 12:28817411-28817433 CCGCCAACGGCTTCTGCCCTGGG - Intergenic
1101451153 12:104780386-104780408 CCGTGACCTGCTTCTGCCTTGGG + Intergenic
1103272850 12:119688018-119688040 CAGCGCCCGGTGCCTGCCCTGGG - Exonic
1104097520 12:125571157-125571179 CCGATCCCGGCTGCTGCGCTGGG - Intronic
1113582233 13:111437762-111437784 CCGCCTCCTGCTTCCGCCCTGGG + Intergenic
1115172865 14:30528711-30528733 CCGCCAAGGGCTTCTGCCCTGGG + Intergenic
1118372644 14:65150671-65150693 CCGCGCCCGGCTACTTGCCTTGG + Intergenic
1122388471 14:101364687-101364709 CTCCGCCTGGCTCCTGCCCTGGG + Intergenic
1123029542 14:105445206-105445228 ACACGCCCGCCTTCTCCCCTGGG + Intronic
1129263653 15:74382628-74382650 CCCAGCCCTGGTTCTGCCCTGGG - Intergenic
1130906873 15:88246931-88246953 ACACGCCCGGCTCCCGCCCTGGG + Intronic
1131144299 15:90001585-90001607 CCGGGCGCGGCTCCTGCGCTGGG - Exonic
1131184990 15:90266251-90266273 CCACGCATGGCTTCTGCCATTGG + Intronic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132238332 15:100238418-100238440 CCAGGCCCGGCTCCAGCCCTGGG - Intronic
1132644091 16:990854-990876 CCAGGCCCGGCTTCTCCCCCAGG + Intergenic
1132700738 16:1221009-1221031 CCGCCCACGGCTTTGGCCCTGGG + Exonic
1132744889 16:1432471-1432493 CCGCCCTCGACTGCTGCCCTCGG - Intergenic
1132812819 16:1809725-1809747 CCGCGCCCACCACCTGCCCTGGG + Intronic
1134380291 16:13718141-13718163 CCGCGCCCGGCCTCTGTTTTGGG + Intergenic
1136278699 16:29194455-29194477 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1136410936 16:30076513-30076535 CCGCCCACGGGTTCTGGCCTGGG + Intronic
1139509053 16:67416139-67416161 CCCCGCCCGGTTTCTCACCTCGG - Intronic
1141576482 16:84967122-84967144 CCGCGCCCGGCCTAACCCCTGGG - Intergenic
1142083091 16:88160536-88160558 CCTCGCCAGGCCTCTGCCCACGG - Intergenic
1142226666 16:88880945-88880967 CCGTGCCCGGGCACTGCCCTGGG - Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1142893113 17:2957869-2957891 GGGCACCCGGCTTCTGCCCGTGG - Intronic
1144905038 17:18635110-18635132 CCGAGCCCGGCTGCGGCTCTCGG - Exonic
1146053008 17:29567465-29567487 CCGCGCGCGCGCTCTGCCCTCGG + Intronic
1146445316 17:32928175-32928197 CCGCGCCCGGACTTTGCCATCGG + Exonic
1148107697 17:45128146-45128168 CCCCGCCAGGCTCCAGCCCTGGG - Intronic
1148838169 17:50477500-50477522 CCGCGCCCGGCTTCTGCCCTGGG + Intergenic
1151625231 17:75271802-75271824 CACCGCCCGGCGTCTGCCCTGGG + Intergenic
1151666289 17:75546885-75546907 CCGCTCCAGGCTCCAGCCCTGGG - Intronic
1159535903 18:69714336-69714358 CAGGGCCCCGCTTCTGCCTTCGG - Intronic
1159586664 18:70289021-70289043 CCGCGCTCGCCTTCTCCTCTCGG - Exonic
1161078116 19:2296322-2296344 CCGCGCCCGGCCTGTGGGCTGGG - Intronic
1162479366 19:10919766-10919788 CCCCGCCCACCATCTGCCCTGGG - Intronic
1162790758 19:13061494-13061516 CCGCGCCCCGCCGCAGCCCTCGG + Intronic
1163161118 19:15464546-15464568 CCCCGCCTGGCTTCCTCCCTCGG + Exonic
1166343357 19:42151300-42151322 CCACCCCCGCCTTCTGCCCATGG - Intronic
1167233945 19:48302647-48302669 CCGAGCCTGGCTTCTCCACTTGG - Intronic
1167569101 19:50275986-50276008 CCACCCTCGTCTTCTGCCCTGGG - Exonic
1167590066 19:50399526-50399548 CCTGGCCCGGCCTCTGCCCCAGG - Intronic
1167590082 19:50399571-50399593 CCTGGCCCGGCCTCTGCCCCAGG - Intronic
1167648896 19:50719296-50719318 CGGCGCCGGGCTCCTGGCCTGGG - Intronic
1167852526 19:52212993-52213015 CATCGCCCAGCTTCTGCCCCAGG + Exonic
925396072 2:3534569-3534591 CCGCAACCCGCTTCTGCCTTGGG - Intronic
926146229 2:10398581-10398603 CCACGCCCGGGGTCTGCCCTGGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
930718929 2:54620180-54620202 CCCGGACAGGCTTCTGCCCTTGG + Intronic
931775052 2:65533192-65533214 CCTGGCCCGGCGTCTGCCCAGGG - Intergenic
934072535 2:88397780-88397802 CCATGCCCTGCTCCTGCCCTTGG - Intergenic
936058797 2:109281199-109281221 GCGACCCCAGCTTCTGCCCTGGG + Intronic
943185210 2:184598533-184598555 CCGCGCTCGGCGCCTGCACTCGG - Exonic
946250068 2:218406344-218406366 CCGCTCCCCGCCTCTGCCTTCGG - Intergenic
947156060 2:227164200-227164222 GCGCGCCGGGCGTCTGCACTCGG - Intergenic
948206849 2:236167208-236167230 CGGCGACCAGCTGCTGCCCTGGG - Intronic
948369014 2:237475556-237475578 GCGCGCCCGGCTGCAGCCGTCGG + Intergenic
948455157 2:238101422-238101444 CAGCTCCCGCCTGCTGCCCTTGG - Intronic
948487265 2:238288824-238288846 CCGCCCCCGGCCTCCGCCATTGG + Intronic
948643917 2:239392112-239392134 CCCAGCCCGGCTGCTACCCTCGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1169673910 20:8132908-8132930 GCGCGCAAAGCTTCTGCCCTTGG - Intronic
1171317574 20:24209071-24209093 CAGCTCCAGGATTCTGCCCTTGG - Intergenic
1171390459 20:24798465-24798487 CCACGCTCGGCTCCTGGCCTGGG - Intergenic
1173139728 20:40471233-40471255 CCAGGCCCGGGTTCTGGCCTAGG + Intergenic
1173382825 20:42561318-42561340 CCCGGCCCAGCCTCTGCCCTTGG - Intronic
1174436409 20:50510264-50510286 CCGCCCCCGGCTCCTCCCCGCGG + Intergenic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176408197 21:6433360-6433382 CAGCACCCGGCTTCCGCCCCGGG + Intergenic
1178757254 21:35363496-35363518 CCGTGCCATGCTTCTCCCCTGGG - Intronic
1178773754 21:35529299-35529321 CCTCTCCCTGCTTCTGCCTTTGG - Intronic
1179626844 21:42653791-42653813 CTGCGCCCGGCGGCTGCACTCGG - Exonic
1179683688 21:43041686-43041708 CAGCACCCGGCTTCCGCCCCGGG + Intergenic
1180014450 21:45073486-45073508 CCGCCCCCGGCTGCTCCTCTGGG + Intergenic
1180066555 21:45415416-45415438 CAGCTCCTGGCTGCTGCCCTGGG - Intronic
1180593269 22:16958078-16958100 CCGCACCCGGCTCCTTTCCTGGG + Intergenic
1180649987 22:17369605-17369627 CCCCGCCCGGCGCCCGCCCTCGG + Exonic
1180869839 22:19139894-19139916 GCGTGCCCGGCTTCTCTCCTTGG + Exonic
1181036305 22:20171419-20171441 CCCCTCCCGGCCTCTACCCTTGG - Intergenic
1182423007 22:30257621-30257643 CCCGGCCCTGCTTCTCCCCTTGG - Intergenic
1183200980 22:36386077-36386099 CGGGGCCCTGCCTCTGCCCTTGG - Intronic
1183502398 22:38188791-38188813 CCAGGCCTGGCTTTTGCCCTTGG - Intronic
1183824096 22:40371127-40371149 CCGAGCCCGGGTTCTGCACCTGG - Intronic
1184640490 22:45867648-45867670 CCGCCTCCGGCCTCTGCCCGCGG + Intergenic
1184698239 22:46151182-46151204 GTGCGCCCGGCTTCTGCCGTCGG + Intronic
949545787 3:5071071-5071093 CCGGGCAAGGTTTCTGCCCTTGG - Intergenic
950682443 3:14594409-14594431 CTGCTCCCAGCCTCTGCCCTCGG - Intergenic
951080441 3:18445200-18445222 GCCCGCCCGGCTTCTCCCCCTGG + Intronic
953995048 3:47513280-47513302 CCGCGCCCGGCCGCTTCCCAGGG + Intronic
954365842 3:50145543-50145565 GTGCGCCCGGCTCCTGCCCAGGG - Intergenic
955499435 3:59569644-59569666 CCACACCCAGCTACTGCCCTTGG - Intergenic
956825994 3:72997148-72997170 CCGCGCCCGGCCCCGGTCCTCGG - Intronic
960989434 3:123301243-123301265 TCGCACACGGCTTCTGCCCTGGG + Intronic
965077894 3:164002566-164002588 CCGTGCATGGCTTCTGCCATTGG - Intergenic
968066535 3:195762351-195762373 CCCCTCCCGGCTTCAGCCCCAGG - Intronic
968141222 3:196258875-196258897 CCGTGCCCAGCCTCTGGCCTGGG + Intronic
969015116 4:4098789-4098811 CTGGCCCTGGCTTCTGCCCTGGG + Intergenic
969719995 4:8888301-8888323 CCGCCCCAGGCTTCTCCCTTTGG - Intergenic
973360262 4:49158725-49158747 CTGCGCCCGGCCTCTACCCTAGG + Intergenic
973399824 4:49629184-49629206 CTGCGCCCGGCCTCTACCCTAGG - Intergenic
976199221 4:82562162-82562184 CCACACCCGGCTCCTGCCCCGGG - Exonic
981577852 4:146223465-146223487 GTGTGCCCAGCTTCTGCCCTTGG + Intergenic
984503613 4:180589773-180589795 CCCCGCCCGGCTCCTCGCCTGGG + Intergenic
985871212 5:2558183-2558205 TTGGGCCCAGCTTCTGCCCTAGG - Intergenic
993504655 5:88694340-88694362 CCGCGCCCCGGCTCTGCGCTGGG + Intergenic
999256203 5:150211173-150211195 GCTCTCCTGGCTTCTGCCCTGGG + Intronic
999996318 5:157095933-157095955 CCGCGCCCGGCCTCAGAGCTGGG - Intronic
1006162383 6:32046183-32046205 CTGGGCCCGGTCTCTGCCCTGGG - Intronic
1015431195 6:133131860-133131882 CCGGCCCCTCCTTCTGCCCTTGG - Intergenic
1019435419 7:1020003-1020025 CCTCGCTGGACTTCTGCCCTGGG - Intronic
1034517258 7:151590606-151590628 CCACGCTAGGCGTCTGCCCTAGG - Intronic
1035127170 7:156616843-156616865 CCGCGCCCCGCTCCTGCCCGCGG + Intergenic
1039943916 8:42114179-42114201 CCACCCCCAGCCTCTGCCCTGGG + Intergenic
1041662633 8:60414346-60414368 CCGTGTCTGGCTGCTGCCCTCGG + Intergenic
1045111846 8:98944320-98944342 CCGCGCCCGGCGTCTGCTAATGG - Intergenic
1051936254 9:22446734-22446756 CCTCCCCCGGCTTCCGCGCTGGG + Intergenic
1061169449 9:128943797-128943819 CTGCTCCCGGCTTCTGGCCTTGG + Intronic
1061289997 9:129645265-129645287 CTGAGCCCTGCTTTTGCCCTAGG + Intergenic
1061327078 9:129870319-129870341 CCGTGCCCGGCTGCTTCTCTGGG + Intronic
1061348100 9:130042911-130042933 GCGCGCCCCGCATCTGCCCGCGG + Intronic
1061903943 9:133686945-133686967 CAGCTCCAGGCTTCTGCCCCAGG - Intronic
1062253950 9:135612396-135612418 CAGGGCCCAGCTGCTGCCCTGGG - Intergenic
1062493643 9:136821600-136821622 CCGCGCCCGGGTTCCTGCCTCGG + Intronic
1062558850 9:137130162-137130184 CCGCGCCCGGGTGAGGCCCTGGG - Intergenic
1062635260 9:137487250-137487272 CCGCACCCAGCTTCTGCCAAGGG + Intronic
1189234611 X:39477636-39477658 CCGCTCTTGGCTTCTGCACTTGG + Intergenic
1198246446 X:134836527-134836549 CTGCTCCAGGCCTCTGCCCTTGG + Intronic
1200128923 X:153830683-153830705 CCGCCTCCGGCTCCTGCCCATGG + Intergenic