ID: 1148842510

View in Genome Browser
Species Human (GRCh38)
Location 17:50508243-50508265
Sequence CTAGGCCACGGGGGGCGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148842510_1148842527 -1 Left 1148842510 17:50508243-50508265 CCCACCCGCCCCCCGTGGCCTAG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1148842527 17:50508265-50508287 GCAGCAGGGCGGGGCGAGGCGGG 0: 1
1: 1
2: 14
3: 148
4: 1171
1148842510_1148842523 -10 Left 1148842510 17:50508243-50508265 CCCACCCGCCCCCCGTGGCCTAG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1148842523 17:50508256-50508278 CGTGGCCTAGCAGCAGGGCGGGG 0: 1
1: 0
2: 2
3: 13
4: 130
1148842510_1148842526 -2 Left 1148842510 17:50508243-50508265 CCCACCCGCCCCCCGTGGCCTAG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1148842526 17:50508264-50508286 AGCAGCAGGGCGGGGCGAGGCGG 0: 1
1: 0
2: 13
3: 121
4: 1053
1148842510_1148842525 -5 Left 1148842510 17:50508243-50508265 CCCACCCGCCCCCCGTGGCCTAG 0: 1
1: 0
2: 1
3: 7
4: 132
Right 1148842525 17:50508261-50508283 CCTAGCAGCAGGGCGGGGCGAGG 0: 1
1: 1
2: 2
3: 29
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148842510 Original CRISPR CTAGGCCACGGGGGGCGGGT GGG (reversed) Intergenic
900890637 1:5447310-5447332 CGAGGCCAGGAGGGGCGGGAAGG + Intergenic
901511932 1:9721869-9721891 CAAGGCCCTGGGGGGCGGGCAGG + Intronic
902431613 1:16367555-16367577 GGAGGCCCCGGGTGGCGGGTGGG - Intronic
903435184 1:23344091-23344113 CGAGGCCCCGGGGTGGGGGTGGG - Intronic
904725293 1:32542320-32542342 CAAGGCCTCGGGGGTCGGGGGGG + Intronic
905237230 1:36558587-36558609 CTAAGACACTGGGGGTGGGTTGG + Intergenic
906654328 1:47536888-47536910 CTGGGCTGCGTGGGGCGGGTGGG + Intergenic
907489594 1:54800592-54800614 CTAGGCTACGGGCAGCAGGTAGG - Exonic
914847092 1:151289295-151289317 CTGGGCCAGGGAGGGCTGGTGGG + Intronic
915600562 1:156920657-156920679 CTACGCCACCGCGGACGGGTCGG + Exonic
922516241 1:226210382-226210404 CTAGGTCTCTTGGGGCGGGTGGG - Intergenic
922817359 1:228459312-228459334 CTCGCCCATGGGGGGCGGGTAGG - Exonic
1063665640 10:8058725-8058747 CTCGGGCACGTAGGGCGGGTAGG - Exonic
1063995005 10:11611269-11611291 CTCGGCCCTGGGGGGCGGCTCGG - Intronic
1064156565 10:12907763-12907785 CTAGTCAACAGGGGGCGGGCAGG - Intronic
1071514007 10:86285083-86285105 CCTGGCCATGGGGGGTGGGTTGG - Intronic
1073057233 10:100710431-100710453 CTAGGCCACATGGGAGGGGTCGG - Intergenic
1073105202 10:101028936-101028958 CTAGGCCACTGGAGCAGGGTGGG - Intronic
1075949253 10:126463013-126463035 CTGGGAGACGGGGGGTGGGTGGG - Intronic
1076884321 10:133254690-133254712 CAAGGCCACGGCGGGCGGAAGGG + Intergenic
1079112299 11:17611604-17611626 CTAGGCCCTGGGGGGCTGATTGG + Intronic
1080941778 11:36926736-36926758 CTAGGCCAGGGTGGACGGTTTGG + Intergenic
1083538244 11:63491134-63491156 CTTGGGCACTGGGGGCGGCTCGG + Exonic
1084169182 11:67392240-67392262 CTAGGGTGTGGGGGGCGGGTGGG + Intronic
1089895697 11:121928148-121928170 AGAGGCCACGGGGGTGGGGTAGG + Intergenic
1092218387 12:6697664-6697686 CTGGCACACGGGGGGCGGGCTGG + Exonic
1098381388 12:69873334-69873356 GCAGCCCACGGGTGGCGGGTTGG + Intronic
1102025770 12:109713762-109713784 CTGGGCCGCGGGGGGCGGGCGGG + Intergenic
1103014002 12:117480164-117480186 CTGGGCCACTGGGGGTGGGGTGG + Intronic
1103219218 12:119229590-119229612 GTAGCCCACGGGCTGCGGGTTGG - Intergenic
1103479287 12:121240815-121240837 CTCCCCCACGGGGGGCGGGTCGG + Exonic
1105214743 13:18277700-18277722 CCAGGCCACTGGGGGAGGGAAGG - Intergenic
1105781181 13:23706261-23706283 GGAGGCCACGTGGGGTGGGTGGG + Intergenic
1111842037 13:93461652-93461674 CTAGGTCCCGGCGGGGGGGTTGG + Intronic
1113464976 13:110506617-110506639 GCAGGCAACGGGGGCCGGGTGGG - Intronic
1114642498 14:24232882-24232904 GTTGGCGACGGGGGGCGGGGAGG - Exonic
1121818026 14:96943268-96943290 CAAGGGCACGGGGGGCCTGTGGG + Intergenic
1122113876 14:99518245-99518267 CCAGGCCAGGGCGGGCGGGGAGG - Intronic
1122771548 14:104099995-104100017 CTGGGCCATGGCGGGCTGGTGGG + Intronic
1124485558 15:30111927-30111949 CCAGCCCACGGGCTGCGGGTTGG + Intergenic
1124518018 15:30385340-30385362 CCAGCCCACGGGCTGCGGGTTGG - Intronic
1124540635 15:30580913-30580935 CCAGCCCACGGGCTGCGGGTTGG + Intergenic
1124758020 15:32426669-32426691 CCAGCCCACGGGCTGCGGGTTGG - Intergenic
1125597102 15:40894207-40894229 CTGGGCGGCGCGGGGCGGGTGGG + Intergenic
1128370463 15:67035749-67035771 CCTGGCCACGGGGTGGGGGTGGG + Intergenic
1128547788 15:68579333-68579355 CTAGGCTGCGGGGGGCGCGGGGG + Intronic
1129189227 15:73927724-73927746 GTACGCCTCGGGCGGCGGGTTGG - Exonic
1129287960 15:74541134-74541156 CGGGGCCACAGGGGGCGGGGCGG - Intergenic
1130381949 15:83379125-83379147 GTAGGCAAGGGGGTGCGGGTGGG - Intergenic
1132518644 16:377426-377448 CCAGTCCCCGGGGGCCGGGTGGG + Exonic
1135601175 16:23784828-23784850 CTGGGCCACCTGGGGTGGGTGGG + Intergenic
1136460634 16:30407972-30407994 CAGGGCCACGGTGGGCGGGGGGG + Intronic
1138589907 16:57994017-57994039 CTGGGCCACGGGGGCAGGGACGG + Intergenic
1144692904 17:17280703-17280725 CTAGGCCGCCGGGAGCGGGCGGG - Intronic
1144721888 17:17476854-17476876 CTAGGCAACGGGCCGTGGGTGGG - Intergenic
1146911745 17:36652895-36652917 CTAGGCCCTGGGGGCCGGTTGGG - Intergenic
1148582356 17:48752719-48752741 TTATGGGACGGGGGGCGGGTGGG + Intergenic
1148842510 17:50508243-50508265 CTAGGCCACGGGGGGCGGGTGGG - Intergenic
1148970784 17:51479424-51479446 CCAGGCCAAGGGGTGGGGGTGGG - Intergenic
1151903538 17:77033501-77033523 CTAGGCCACGTGGAGCGGCGGGG - Intergenic
1152391377 17:80005892-80005914 CTAGGCCCCCGGGGTGGGGTGGG + Intronic
1152636543 17:81432732-81432754 CTGGGGCTCGGGGGGAGGGTGGG - Intronic
1158478490 18:57801892-57801914 GCAGGCCAAGGGGGTCGGGTAGG + Intronic
1160659301 19:290955-290977 CCAGGCCAGGCGGGGCGGGATGG + Exonic
1160734451 19:655870-655892 CCAGGCCACGGCGGGGGGGAGGG + Intronic
1160846514 19:1168481-1168503 CAAGGCCACGGGGGACGGTGAGG - Intronic
1160914552 19:1490418-1490440 CTATGGCGCCGGGGGCGGGTCGG - Intronic
1163593156 19:18205364-18205386 CCAGGGCACTGGGGGCGGGCTGG - Intergenic
1165093462 19:33398135-33398157 CCAGGCCACGGGGAGCAGGGCGG - Intronic
926054484 2:9766400-9766422 CTGGGCCACGGGGGCAGGGCTGG - Intergenic
927154577 2:20214059-20214081 CTAGGCCACTGCGGGTAGGTGGG + Intronic
929441149 2:41966713-41966735 GGACGCCAAGGGGGGCGGGTAGG + Intergenic
930358074 2:50346227-50346249 CCTGGCCCCGGGGGGCGGGGAGG - Intronic
931312618 2:61096479-61096501 CTAGGCAGCTGGGGGCTGGTGGG - Intronic
932321276 2:70823597-70823619 CTAGGGCCCGGAGGGTGGGTGGG - Intergenic
933666872 2:84971319-84971341 CTCGGCCGCGGGGGCGGGGTGGG - Exonic
934260971 2:91477360-91477382 CGAGGCGGCGGGGGGCGGGGGGG - Intergenic
934299579 2:91769038-91769060 CCAGGCCACTGGGGGAGGGAAGG + Intergenic
935284514 2:101552283-101552305 CTAGGCAGCGGGGAGCTGGTGGG - Intergenic
937208301 2:120251087-120251109 CTAGGGGATGGGGGGCAGGTGGG + Intronic
941529969 2:166655910-166655932 CTTGGCCAAGGGTGGAGGGTGGG + Intergenic
943540505 2:189208169-189208191 CTAGGCAAAGGAGGGTGGGTTGG - Intergenic
945305306 2:208254391-208254413 CTAGGCCACACGGGGCGAGAGGG - Intronic
946404441 2:219484885-219484907 CGAGGACTCGGGGGGCGCGTCGG + Exonic
947748501 2:232521433-232521455 CTGGGGCACGGGGGGCAGGGTGG - Intronic
1171452824 20:25248003-25248025 CGGGGCCTCGGGGGGCGGGGCGG - Intergenic
1172763241 20:37336604-37336626 CTGGGGGACGGGGGGCTGGTGGG - Intergenic
1174270682 20:49366012-49366034 GTAGGCCACTGGGGATGGGTTGG + Exonic
1176209013 20:63908278-63908300 CTAGGCCAGGGGGTGAGTGTGGG + Intronic
1179570553 21:42276129-42276151 CAAGGCCACGGGAGGCAGGAGGG + Intronic
1183369181 22:37422935-37422957 CTGGGCCTCGGGGGGGGGGGGGG + Intronic
1184369051 22:44070993-44071015 CCAGGCCAAGGCGGGCGGGCAGG - Intronic
961820956 3:129575437-129575459 CGAGGCCATGTGGGGCGGGTGGG + Intronic
963188855 3:142447372-142447394 CTAGGCTCCGGGGGCCGGGTGGG + Intronic
968433976 4:575747-575769 CGAGGCCACGCCGGGCGAGTCGG - Intergenic
968916358 4:3498624-3498646 CTAGGCCAAGAGGGGGTGGTGGG - Intronic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
978222225 4:106290663-106290685 CTAGTCCATGGTGGGGGGGTTGG - Intronic
978567824 4:110102920-110102942 ATGGGGGACGGGGGGCGGGTAGG + Intronic
982746119 4:159104610-159104632 AGAGGCCACGGAGGGCGGCTGGG - Intronic
985758557 5:1733342-1733364 CAAGGCCATGGGGGGTGGGGAGG - Intergenic
985781112 5:1872342-1872364 CCAGGCCACGGGGGGCGGGGGGG - Intergenic
985997078 5:3602930-3602952 CGAGGACACCGGGGGCGCGTCGG + Intergenic
988369294 5:30346030-30346052 GGAGCCCACGGGGGGCGGGGGGG - Intergenic
989380868 5:40808358-40808380 TCAGGCCTCAGGGGGCGGGTTGG + Intergenic
992716123 5:79513579-79513601 CTCGGCGGCGGGGGGCGGGAAGG - Exonic
993095646 5:83474696-83474718 CGAGGCCAATGGGGGCGGGGCGG + Intronic
993828969 5:92729510-92729532 CAAGGCCATGGGGTGGGGGTGGG - Intergenic
997250149 5:132382379-132382401 GAAGGCCACAGGGGGTGGGTTGG - Intronic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
998436012 5:142109158-142109180 CTGGGCCTGGAGGGGCGGGTCGG + Intronic
998721690 5:144959066-144959088 CTAGGCCATGGGGATAGGGTGGG - Intergenic
999305662 5:150517942-150517964 CTAGGCCAAGGGGTGGGGCTGGG + Intronic
999773593 5:154793669-154793691 CTAGGCTCCGGTGGGCGAGTGGG - Exonic
1004922611 6:20390698-20390720 CTGGGCCATGGGCTGCGGGTTGG + Intergenic
1005893736 6:30160901-30160923 CTTGGCCACGGGGGAAGGGCTGG + Exonic
1006180772 6:32152152-32152174 CTAGACCAGGCGAGGCGGGTGGG + Intronic
1006671298 6:35731473-35731495 CAAGGCAACTGGGGGCGGGACGG - Intergenic
1015013771 6:128384512-128384534 CTAGGCCACATGTGGCTGGTGGG + Intronic
1017631068 6:156397037-156397059 CTGGGCCAGCGGAGGCGGGTGGG - Intergenic
1017793901 6:157823875-157823897 CTCGCCCCCGCGGGGCGGGTGGG + Intronic
1019191266 6:170252322-170252344 CTAGGACCCTGGGGTCGGGTTGG - Intergenic
1023955785 7:44885567-44885589 CGAGGCCGCGGAGGGCGGGACGG - Intergenic
1029293144 7:99517902-99517924 CTGGGCCACGGGCCGTGGGTTGG + Intronic
1034455533 7:151167894-151167916 TTGGGCCGCGGGGGGCGGGTGGG - Intronic
1037817706 8:22120655-22120677 CAAGGCCCCGAGGGGCAGGTGGG + Intronic
1038397537 8:27258150-27258172 CTCGGCCAAGGGGTGAGGGTGGG - Intronic
1038562066 8:28589272-28589294 CTCAGCCACGGGGAGCAGGTGGG + Intergenic
1039417835 8:37410704-37410726 CTAGGCCACAGGGGCTGGGAGGG - Intergenic
1039493422 8:37964527-37964549 CGAGGGCTTGGGGGGCGGGTGGG + Intronic
1041693596 8:60714079-60714101 CCAGGCCTCGGCGGGCGGGGTGG + Intronic
1057274497 9:93669193-93669215 CTTAGCCACGGGGGGCTGGGGGG - Intronic
1059314210 9:113410390-113410412 GTAGGCCACGTGGGGCGGAACGG - Exonic
1059499050 9:114735068-114735090 GGAGGCCAAGGGGGGCGGGGTGG + Intergenic
1060197848 9:121634856-121634878 CGAGCCCACGGGGTGAGGGTGGG - Intronic
1061693558 9:132354797-132354819 CTAGGTCCCGGTGGGCGGATGGG - Intronic
1062405277 9:136393251-136393273 TCAGGCCACGGGGGGCAGGCGGG + Intronic
1062599658 9:137314177-137314199 CCAGGCCTCGGCGGGCAGGTTGG - Intronic
1186743782 X:12545165-12545187 GTGGCCCACGGGTGGCGGGTTGG - Intronic
1191251938 X:58263957-58263979 CTCACCCACGGGGGGCTGGTGGG + Intergenic
1197519453 X:127479077-127479099 CGAGGCCAAGGGGGGCAGATTGG + Intergenic