ID: 1148842715

View in Genome Browser
Species Human (GRCh38)
Location 17:50508983-50509005
Sequence GGGCCTCAGGGACCACTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 313}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148842706_1148842715 17 Left 1148842706 17:50508943-50508965 CCTTGGGGATGGGGACATAGGAA 0: 1
1: 0
2: 2
3: 32
4: 320
Right 1148842715 17:50508983-50509005 GGGCCTCAGGGACCACTGGCTGG 0: 1
1: 0
2: 1
3: 34
4: 313

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148842715 Original CRISPR GGGCCTCAGGGACCACTGGC TGG Intronic
900514214 1:3073666-3073688 GGGCCTGGGGGACCCCGGGCCGG + Intronic
900529316 1:3144945-3144967 GGGCCTCAGGAACCCCTGTGCGG + Intronic
900531346 1:3155014-3155036 AGGCCTCAGGGCCCACAGGCAGG - Intronic
900899220 1:5505478-5505500 GGCCCCCAGGGACTCCTGGCTGG + Intergenic
901712719 1:11128301-11128323 GGCCCTCTGGGACGGCTGGCTGG + Intronic
901773038 1:11540462-11540484 GGGGCTCAGGGAACCTTGGCAGG - Intergenic
903384957 1:22920224-22920246 AGGCCACAGTGCCCACTGGCTGG + Intergenic
903578917 1:24356691-24356713 GAGCCTCAGGGCTCACTGGTGGG + Intronic
903653283 1:24933768-24933790 GGGCCTCAGCGGACACTGCCAGG + Intronic
903668284 1:25021211-25021233 GGGCCGCAGGGACCTCAGGGAGG + Intergenic
904190204 1:28737335-28737357 GGGCCTCGGAGCCCACGGGCCGG + Intronic
904465754 1:30706683-30706705 GCGACTCAGCGAACACTGGCTGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906154018 1:43603592-43603614 GGGACTGAAGGACCACGGGCTGG - Exonic
909182271 1:72439597-72439619 GGGCCTAAGGGAACATTGGCTGG - Intergenic
910384561 1:86666576-86666598 GGCCCACAGTGACCACTGTCTGG - Intergenic
910515288 1:88053906-88053928 GGCCCACAGTGACCACTGCCTGG + Intergenic
912694219 1:111828783-111828805 GGGCCTCATGCAGCAGTGGCTGG - Intronic
914908183 1:151763539-151763561 GCGCCGCAGGCAGCACTGGCGGG - Exonic
915081109 1:153353410-153353432 GGGCCTCAGAGACCTCAGGATGG + Intergenic
915795947 1:158733617-158733639 AGGACTCAGGAACCCCTGGCTGG + Intergenic
916170559 1:161998580-161998602 AGGACTCAGGGGTCACTGGCAGG + Intronic
916674229 1:167053014-167053036 AGGTCTCATGGACCAGTGGCTGG - Exonic
917476610 1:175374242-175374264 GCTCCTCAGGGTACACTGGCAGG - Intronic
917651041 1:177077782-177077804 GGGCCTCAGGAAAGGCTGGCTGG - Intronic
917958529 1:180124734-180124756 GGGCCTCATGGGCCACAGGATGG + Intergenic
919934905 1:202245107-202245129 GGGCCTTAGGGCCCTCTGGCTGG - Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
923101874 1:230823437-230823459 GAGCCTCAGGGCCCATTTGCTGG - Intergenic
1064408358 10:15084250-15084272 GGGCCTCACGGACTGCTGGTGGG + Intronic
1066429848 10:35341122-35341144 GGGCCCCAGCGACCACTGTAAGG - Intronic
1067468123 10:46516422-46516444 TGGCCCCAGTGACCACTGGCTGG - Intergenic
1067561434 10:47307524-47307546 GTGCATGAGGGACCACAGGCTGG - Intronic
1069554971 10:69392029-69392051 GGGCCTGAGGTTCCACAGGCAGG - Intronic
1069769832 10:70891189-70891211 GGGCTTCAGGCACCCCTGCCTGG - Intergenic
1072543530 10:96416571-96416593 GGGCAGCAGGAAACACTGGCTGG - Intronic
1073463037 10:103677447-103677469 GAGCCTCAGGGACATCTGGCTGG + Intronic
1073938578 10:108665471-108665493 GGGCCTCAGTGCCCACTGCCTGG + Intergenic
1075708624 10:124518362-124518384 GGGACTGGGGGACCCCTGGCTGG - Intronic
1076028762 10:127140422-127140444 GGACCTCAGGGTCAACTTGCTGG - Intronic
1076159267 10:128229750-128229772 AGGCCTCAGGGACCACCCACTGG - Intergenic
1076631169 10:131853208-131853230 GGGCCTTTGGGCCCACGGGCTGG - Intergenic
1076635004 10:131876088-131876110 GGCCTGCAGTGACCACTGGCAGG - Intergenic
1076841282 10:133047059-133047081 TCGCCTCAGAGACCAGTGGCTGG + Intergenic
1077014314 11:393142-393164 GGGCCTCAGAGCCCATTTGCTGG + Intronic
1077134445 11:991562-991584 GGCCCTCAGGCCTCACTGGCAGG - Intronic
1077185091 11:1232228-1232250 GGGCCACGGGGACCCCTGGGTGG + Intronic
1077541353 11:3147951-3147973 GGACCTCTGGGGCCACTAGCTGG + Intronic
1078600238 11:12724130-12724152 TGGCCTCAGGGGCCACTGGAAGG - Intronic
1078912407 11:15745270-15745292 GGGCCTCAGGAACTGCAGGCAGG - Intergenic
1079266363 11:18936871-18936893 GGGCTCCAGGGACCAGGGGCTGG - Intronic
1079268506 11:18959102-18959124 GGGCTCCAGGGACCAGGGGCGGG - Intergenic
1083948731 11:65941820-65941842 GGGCCTTAGGGCAGACTGGCTGG + Intergenic
1083967637 11:66052320-66052342 CAGCCTCAGGGCCCACTTGCCGG - Exonic
1084101880 11:66955277-66955299 GGGGCTCTGGGACCAGTGGCAGG - Intronic
1084366527 11:68704962-68704984 GAGCCACAGGGAGCACTGCCCGG - Intergenic
1089257419 11:117201160-117201182 GGGTCTCTGGCATCACTGGCAGG + Intronic
1089349567 11:117814716-117814738 GGGATTCAGGGTCCCCTGGCAGG + Intronic
1089349777 11:117815795-117815817 GAGACTCAGGGTCCCCTGGCAGG + Intronic
1089634909 11:119805821-119805843 AGGCCTCGGGGCCCACTGCCTGG + Intergenic
1090676859 11:129007017-129007039 GGGCCACAGGGAGTACTGCCAGG + Intronic
1090804935 11:130196975-130196997 GGGCCTGAGGGACAGATGGCCGG - Intronic
1092257824 12:6936868-6936890 GGGCCTCAGAGACCCCAGGGAGG - Exonic
1092907472 12:13115156-13115178 GGGCCCCTGGGAGCACTGGCCGG + Intronic
1093046668 12:14454374-14454396 GAGCCTCAGAGACCAAAGGCAGG - Intronic
1093826023 12:23690124-23690146 AGGACTCAGGGACCGCTTGCTGG - Intronic
1096789346 12:54035205-54035227 GGGCCTCTAGGACCACTTGCTGG - Exonic
1098096703 12:66964594-66964616 GGGGATCAGGGAAAACTGGCCGG - Intergenic
1101317574 12:103643500-103643522 GGGCATCAGAGAGCACTGGGAGG - Intronic
1102673544 12:114640260-114640282 GGGCCCCAGGGATCAATGGATGG - Intergenic
1102733147 12:115132377-115132399 GGGCCTCAGGCACAATTGGATGG - Intergenic
1103064394 12:117885064-117885086 GGGCCTCAGTTTCCACTGCCCGG + Intronic
1103178816 12:118889739-118889761 GGGCCCCAGGTACAACTGGGTGG + Intergenic
1104719994 12:131039924-131039946 CGGCCTCAGGGACCGCCGGCAGG - Intronic
1105503362 13:20990677-20990699 GGGCCTCAGGTACCAATCACAGG + Intronic
1105676816 13:22680748-22680770 AGGCCTCAGGGATAACTGGAAGG - Intergenic
1106283935 13:28302746-28302768 TAGCCCCAGGGATCACTGGCTGG - Exonic
1113911500 13:113843470-113843492 GGGGCTCAGTGACCGCTGCCTGG + Intronic
1115345329 14:32336860-32336882 GGGCCTCAGGGGCTGCTGGTGGG - Intronic
1117110413 14:52447265-52447287 GGCCCACAGGGAGTACTGGCAGG - Intronic
1118780091 14:69002170-69002192 AGGGCTCATGGACCTCTGGCAGG - Intergenic
1119767499 14:77199622-77199644 GGGGCTCAGAGACCACAGCCCGG - Intronic
1120439583 14:84519924-84519946 GGCCCACAGTGACCACTGCCTGG + Intergenic
1120698111 14:87666826-87666848 GAGCCACAGGGGCCACTGGTAGG + Intergenic
1120984767 14:90324931-90324953 GTGGCTCAGGGAGCAATGGCAGG + Intronic
1121583379 14:95046812-95046834 GGACCTTTGGGACCACTGGGTGG - Intergenic
1122414143 14:101540777-101540799 GGGCCTCTGGGGCCACAGGCTGG + Intergenic
1122803889 14:104247130-104247152 GGGCCACAGGGTGCCCTGGCCGG + Intergenic
1122922786 14:104886856-104886878 GGCGCTGGGGGACCACTGGCTGG - Exonic
1123116221 14:105895267-105895289 GGGCTTCTGGGACCACTGGGTGG + Intergenic
1123429311 15:20201380-20201402 GGCCCCCAGCCACCACTGGCAGG - Intergenic
1124341289 15:28890664-28890686 GGGCCCCAGGGATTAGTGGCAGG - Intronic
1124411779 15:29443096-29443118 GGTCCTCAGGTACCTCTTGCTGG + Intronic
1124593851 15:31077618-31077640 GGGCCTCGGGGATCCCTGGAAGG + Intronic
1124899529 15:33809391-33809413 GGGCCTCAGTGGGCACTTGCTGG - Intronic
1124965824 15:34433042-34433064 GGGCCCCAGGGATTAGTGGCAGG + Intronic
1125577296 15:40764391-40764413 GGGACTCAGCGAGCTCTGGCCGG + Intronic
1125724486 15:41861335-41861357 GGAGCTCAGGCAGCACTGGCTGG + Intronic
1125749846 15:42020813-42020835 GGGCCTCAGGGAGGGCTGGTAGG - Intronic
1126686381 15:51252079-51252101 GGCCTACAGGCACCACTGGCTGG - Intronic
1127390871 15:58504128-58504150 GGGCCACAGGGCACCCTGGCTGG + Intronic
1127800088 15:62470523-62470545 AGGCCTCAGAGAGCACGGGCAGG + Intronic
1128206592 15:65858198-65858220 GGGCCTCATGGGCCACTGTAAGG - Intronic
1128439214 15:67688245-67688267 GGGCCTTGGGGACCTCTGGGAGG + Intronic
1128654883 15:69453198-69453220 GGGCCCCCGGGACCACGTGCGGG + Intronic
1129239367 15:74242518-74242540 GGCCCTGAGGGGCCACTGGCAGG - Intronic
1129333674 15:74840199-74840221 GGGCCTTAGCGACCACTGGGGGG - Intronic
1129518871 15:76173159-76173181 GGGTCTCAGGGACACGTGGCCGG + Intronic
1130085853 15:80778190-80778212 GGTTCTCAGAGAACACTGGCAGG + Intergenic
1130661001 15:85831290-85831312 GGACCTCAGGGAGAGCTGGCAGG + Intergenic
1130939205 15:88493896-88493918 CAACCTCAGGGACCACTGGGTGG - Intergenic
1131075047 15:89490240-89490262 GGGCCTCAGGGAAGCCTGGAAGG - Intronic
1131150760 15:90046038-90046060 GGGCCCCTGGGAACCCTGGCTGG - Intronic
1132032507 15:98450268-98450290 GGCCCACAGTGGCCACTGGCAGG + Intronic
1132654628 16:1036647-1036669 GGGCCTGAGGGGCCACTGCCTGG + Intergenic
1132659611 16:1055506-1055528 GGCCCTCAGAGACCCTTGGCAGG - Intergenic
1132691368 16:1183221-1183243 TGGCCTCTGGGACCCCTGACGGG + Intronic
1135582412 16:23640017-23640039 GAGCCTCTGGGACTACAGGCTGG + Intronic
1136282622 16:29222660-29222682 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1136285221 16:29236665-29236687 TGGGCTCAGGGCCCACTGGCTGG + Intergenic
1136568341 16:31082864-31082886 GGGCCTCCGGGGCCAGGGGCAGG + Intronic
1136580017 16:31145788-31145810 GGGCCGCAGGGACACCTGCCAGG - Exonic
1136855007 16:33648352-33648374 GGCCCCCAGCCACCACTGGCAGG + Intergenic
1137000001 16:35221532-35221554 GCGCCTCCTGGACCACTGCCGGG - Intergenic
1137013078 16:35344047-35344069 GCGCCTCCTGGACCACTGCCGGG - Intergenic
1137033027 16:35543235-35543257 GCGCCTCCTGGACCACTGCCGGG - Intergenic
1137804987 16:51296598-51296620 GGGCGGCTGGGACCACTAGCAGG + Intergenic
1138083671 16:54115176-54115198 GGACCACAGGGAGGACTGGCAGG - Exonic
1138850477 16:60622887-60622909 GGTCTGGAGGGACCACTGGCTGG - Intergenic
1140273660 16:73488426-73488448 GGACCTCATGGCCCAATGGCAGG + Intergenic
1141166654 16:81665315-81665337 TGGCCACAGGGACCACAGGTAGG + Intronic
1141402731 16:83764659-83764681 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141402745 16:83764729-83764751 GGGCCTCAGGGAAGGCAGGCAGG - Intronic
1141603524 16:85140190-85140212 GGACCTCAGGGGCCACTGGAGGG + Intergenic
1141806946 16:86348073-86348095 GGGGCTCAGGGAGCACAGCCTGG + Intergenic
1142086996 16:88188585-88188607 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1142090287 16:88206290-88206312 TGGGCTCAGGGCCCACTGGCTGG + Intergenic
1203116586 16_KI270728v1_random:1496837-1496859 GGCCCCCAGCCACCACTGGCAGG + Intergenic
1142624484 17:1183198-1183220 GTGCCTTGGGGAGCACTGGCTGG - Intronic
1142765989 17:2064661-2064683 GTGCCCCAGGGACCCCTGGGGGG + Intronic
1142902348 17:3019944-3019966 GGGCCACAGGCACCAATGGGCGG - Intronic
1143145083 17:4770009-4770031 CTGCATCAGGGGCCACTGGCTGG + Intergenic
1143626750 17:8114640-8114662 GGGCTTCAGGGCCCACTGACTGG - Intronic
1146352975 17:32111461-32111483 GGGCCTCCTGGGCCACGGGCTGG - Intergenic
1147997974 17:44371657-44371679 GGGCCTCAGGGAAGACTAGAAGG - Intergenic
1148842715 17:50508983-50509005 GGGCCTCAGGGACCACTGGCTGG + Intronic
1150266337 17:63834561-63834583 GGGCATCCGGTGCCACTGGCAGG + Exonic
1151443837 17:74150587-74150609 GGAACTCAGGGAGCTCTGGCCGG - Intergenic
1151934904 17:77255566-77255588 AGGCCTGAGTCACCACTGGCTGG + Intergenic
1152826036 17:82465457-82465479 GGGCCTCAAGAAACACTGACTGG + Intronic
1152848256 17:82615824-82615846 GGGCCTCCTGGGCCACGGGCTGG - Exonic
1153339783 18:3961720-3961742 GGGCCTCAGGGCCAACTGACTGG + Intronic
1154203314 18:12315845-12315867 GGGCTTCATGTACCAGTGGCCGG + Intronic
1155574243 18:27227702-27227724 GGGCCACAGGGGCCTTTGGCAGG + Intergenic
1155656203 18:28195638-28195660 GGGCTTTTGGGGCCACTGGCAGG + Intergenic
1156464834 18:37342312-37342334 GGGCCCTAGGGACTGCTGGCAGG - Intronic
1159730512 18:72021385-72021407 GAACCTCAGGGAGCACTGGAAGG + Intergenic
1160318516 18:77869257-77869279 GGGGCTCGGGGCCCACTGCCTGG + Intergenic
1160857367 19:1223577-1223599 AGGCCTCAGGGACGACGGGAGGG - Intronic
1160907947 19:1460575-1460597 GGGCCTCAGGGCCCCGAGGCTGG + Intronic
1161153280 19:2720611-2720633 GGGCTTCAGGGACCCAGGGCTGG - Intronic
1161543576 19:4866971-4866993 GGGCCCCAGGTCCCACTGCCAGG + Intronic
1163646972 19:18495127-18495149 GTGACACAGGGACCCCTGGCAGG + Intronic
1164412554 19:28018000-28018022 GTGCCTCAGGGACCTCAGGGAGG + Intergenic
1165606272 19:37107283-37107305 AGGCCACAGGGACCTCTGCCTGG - Intronic
1166194891 19:41198946-41198968 GGTCCCCAGGGACACCTGGCTGG - Intronic
1166368735 19:42290289-42290311 GGGGCTCAGGGTCCAGTGGGGGG - Exonic
1166410853 19:42554673-42554695 GGACCTCAGGGGTGACTGGCAGG + Intronic
1167433149 19:49464651-49464673 GGCCCTCAGGGACCCCTGCCCGG + Exonic
1167488760 19:49779826-49779848 GGATCTCAGGAGCCACTGGCTGG + Intronic
1168238068 19:55076004-55076026 GGGTCTCAGGGAGGACGGGCTGG + Intronic
1168670451 19:58237564-58237586 GGGCCCCTCGGACCGCTGGCGGG - Intronic
926047157 2:9718073-9718095 GGGCCTCAGAGAACCCTGGTGGG - Intergenic
926243795 2:11107249-11107271 GGTCCTCAGTGACCACGTGCTGG - Intergenic
926369717 2:12167707-12167729 GGGCAGCAGAGACCACTGGCAGG + Intergenic
927488256 2:23503993-23504015 GGCCCTCAGGGACCTCTGGCTGG - Intronic
929947172 2:46380385-46380407 GGGCTACAGGGGCCAGTGGCTGG - Exonic
930014222 2:46959433-46959455 GGGTCTCAGGCACATCTGGCTGG + Intronic
932705487 2:74021169-74021191 GAGCCTCAGGGCCACCTGGCTGG - Intronic
934579755 2:95428514-95428536 GGGACACAGGGACCACCTGCTGG + Intergenic
934599692 2:95648211-95648233 GGGACACAGGGACCACCTGCTGG - Intergenic
934945349 2:98537374-98537396 GGGCTTCAGGAAGCCCTGGCTGG + Intronic
937301639 2:120846365-120846387 GGGCCTCAGCCATAACTGGCTGG + Intronic
937357778 2:121209095-121209117 GGGGCTCAGGATCCCCTGGCTGG + Intergenic
941067399 2:160919058-160919080 GGGCCTCTGAGCCCGCTGGCCGG + Intergenic
946032399 2:216715651-216715673 AGGACTCAGGGAACTCTGGCAGG + Intergenic
946495181 2:220189464-220189486 GGCCCTCAGGGGCCAGAGGCTGG + Intergenic
948233605 2:236370462-236370484 GCTGCTCAGGGACCACTGACCGG - Intronic
948603435 2:239120287-239120309 AGGCCTCAGGGACCAGTGGTAGG + Intronic
948627674 2:239279092-239279114 GGGCAGCAGGGCCCACAGGCCGG + Intronic
948686597 2:239674395-239674417 GGGCCTGAGGACCCACTGGTGGG + Intergenic
949046938 2:241876680-241876702 GGGCCTCAGGGGCCAACTGCAGG + Intergenic
1170339328 20:15305558-15305580 GGGCCTCTGGTATCAATGGCTGG + Intronic
1171432088 20:25089389-25089411 GGGGCTCAGGGTCCTCTGGGGGG - Intergenic
1172193802 20:33078294-33078316 GGGCCCCAGGGATCTCTGGATGG + Intergenic
1172633525 20:36394312-36394334 GGGCCTGAGGAAGCGCTGGCTGG + Intronic
1172775137 20:37402899-37402921 GGGATTCAGGGACCACAGACAGG - Intronic
1174294697 20:49537267-49537289 GGGCCGTAGGAACCACTGGGCGG - Intronic
1175212068 20:57365892-57365914 GTTACTCAGGGACCACTGGCAGG + Intronic
1175887879 20:62302709-62302731 CGGCGCCAGGGACCACAGGCGGG - Intronic
1176028785 20:63000208-63000230 GGGCAACAGAGACCATTGGCAGG + Intergenic
1176939830 21:14911320-14911342 GGCCCACAGTGACCACTGCCTGG + Intergenic
1179611840 21:42557000-42557022 GTGCTTCAGGGTCCACTTGCTGG - Intronic
1180801401 22:18633812-18633834 GGGCCGCAGGGAACCCTGGCAGG - Intergenic
1180899665 22:19361200-19361222 GTGCCTGAGGGAGAACTGGCAGG + Intronic
1181034934 22:20165351-20165373 GGGCCACATGGACGGCTGGCTGG - Intergenic
1181171597 22:21013028-21013050 GGGCCCCAGGTACCACTGGAAGG - Intronic
1181177759 22:21047490-21047512 GGGCCCCAGGTACCACTGGAGGG + Exonic
1181220321 22:21361449-21361471 GGGGCGCAGGGAACCCTGGCAGG + Intergenic
1181508886 22:23380008-23380030 GGGCCACATGGACGGCTGGCTGG + Intergenic
1182097921 22:27638427-27638449 GATGCTCAGGGACCCCTGGCTGG + Intergenic
1184684122 22:46088298-46088320 GGGCATCAGGCACCACCGGTGGG - Intronic
1185070068 22:48651326-48651348 GGGCCGCAGTGGCCACTGGGAGG + Intronic
1185132180 22:49045447-49045469 GGGCTTCAGAGCCCACTGGAGGG - Intergenic
1185212195 22:49576622-49576644 GGGGCTCAGGGACTTGTGGCTGG - Intronic
949681529 3:6519934-6519956 GGGCCACTGGGACCCCTGGAGGG - Intergenic
950143020 3:10628170-10628192 GGGCCTCAGGGCCCATGGCCAGG + Intronic
950184701 3:10937918-10937940 GGTCATCAGGGTCCACTGCCTGG - Intronic
950529606 3:13545604-13545626 GGTCATCAGGGACTCCTGGCGGG + Intergenic
950841996 3:15976650-15976672 AGGCCTGAGGGACCAGAGGCAGG - Intergenic
952258127 3:31713168-31713190 GGGCCTCACGGGCCACAGTCAGG - Intronic
952945378 3:38475307-38475329 GGGCCTCAGGGTCCACAGAGAGG - Intronic
952959388 3:38580090-38580112 TGGCCTCTGGGACCACAGGGAGG + Intronic
953907187 3:46874309-46874331 ATGCCTCAGGGGACACTGGCTGG - Intronic
954257162 3:49414935-49414957 AGACCTCAGGGACAACTGCCGGG + Exonic
960723884 3:120650923-120650945 GACCCTCAGGGACCAGTGGAAGG - Intronic
961504118 3:127358918-127358940 GGGCCTCAGTGAGAACTGGGTGG + Intergenic
961880388 3:130057584-130057606 AGGCCACAGGGACCTCTGCCTGG + Intergenic
962270808 3:133976764-133976786 GGGCCGCAGGGACAACTGGTGGG + Intronic
962676921 3:137764508-137764530 GGGCTTCAGGCACCAGGGGCTGG - Exonic
963036242 3:141031628-141031650 GGGCCTCTTGGAACACTGTCTGG - Intergenic
963049023 3:141126329-141126351 GGGCCTCAGGGATGAAAGGCTGG - Intronic
967087588 3:186108873-186108895 GGGCCTGTCGGACCAGTGGCCGG + Intronic
967229475 3:187323954-187323976 GGGCCTAAGGGGCCACTGTAAGG + Intergenic
968753393 4:2401919-2401941 GGGCTTCAGGGAGCGCTGGGAGG - Intronic
968829333 4:2924411-2924433 GGGGCACAGGGACCCCTGCCAGG + Intronic
968902387 4:3437802-3437824 GGGCCTCTGGGGCCACTGCTGGG + Intronic
968992778 4:3925938-3925960 AGGCCACAGGGACCTCTGCCTGG + Intergenic
969822697 4:9732423-9732445 AGGCCACAGGGACCTCTGCCTGG - Intergenic
972339037 4:38134913-38134935 GGGACTCAGGAACTACTGGTGGG - Intronic
972579351 4:40380810-40380832 GGCCCGCAGTGACCACTGCCTGG - Intergenic
976146066 4:82043962-82043984 TCCCCTCAGGGACCCCTGGCGGG - Intronic
978654467 4:111049543-111049565 AGCCCTCAGTGACCACTGCCTGG - Intergenic
983005144 4:162475420-162475442 GGGACTCAGGCCCCTCTGGCTGG + Intergenic
983593671 4:169441944-169441966 GGGTCTCAGGGCCCTCTGGAAGG - Intronic
985553750 5:546182-546204 GGGCTGCAGGGAGCACAGGCAGG + Intergenic
985723681 5:1504357-1504379 GGGGCTCCAGGGCCACTGGCTGG + Intronic
985780048 5:1865730-1865752 GGCCCTCAGGGACAGCTGGTGGG + Intergenic
985836762 5:2277421-2277443 CAGCCTCAGGGACCACAGGAAGG - Intergenic
986599175 5:9454160-9454182 AGGCATCAGGGACGACAGGCTGG + Intronic
987576390 5:19733813-19733835 GTGTCTCAGGCACCACTGCCTGG + Intronic
988097620 5:26637951-26637973 GGGGCTCAGTGGGCACTGGCAGG - Intergenic
988236875 5:28557212-28557234 GGCCCACAGGGAGCACTGCCAGG + Intergenic
989368242 5:40679783-40679805 GCGCCGCAGGGAAGACTGGCGGG - Exonic
989657633 5:43761547-43761569 GGCCCACAGTGACCACTGCCTGG + Intergenic
990202818 5:53397292-53397314 GGTCCACAGGGACTACTGCCTGG + Intergenic
992888466 5:81182342-81182364 GGGCCTCAGGGCTCTATGGCTGG + Intronic
995573058 5:113502348-113502370 GGCCCGCAGGGACCATTGCCTGG + Intergenic
996434844 5:123423095-123423117 GGGCATCAGGGACCGGGGGCGGG - Exonic
997530549 5:134578963-134578985 GGGTCTCAGGGGCCAGTGGCGGG - Exonic
997721148 5:136079310-136079332 GAGCCCCAGGGACTGCTGGCGGG - Intergenic
997823954 5:137089938-137089960 AGGCCACAGAGGCCACTGGCAGG + Intronic
999202217 5:149824601-149824623 GGGCCTCAGCGACCACTCTTGGG - Intronic
999308266 5:150534819-150534841 GGGCCTCATGGCCCAGTGGGTGG + Intronic
1000021527 5:157322943-157322965 AGCCCTCGGGGACCACTGGCAGG - Exonic
1001858966 5:175036622-175036644 GGGGCTCAGGGACCCCTGTGAGG + Intergenic
1002101024 5:176857687-176857709 GAGCCCCAGAGCCCACTGGCTGG - Intronic
1002586339 5:180251244-180251266 GGGCTTCAGGGCCTGCTGGCTGG - Intronic
1003030563 6:2597090-2597112 GGGGCTCAGTGACCAGAGGCAGG - Intergenic
1003330399 6:5124150-5124172 GGGCCTCAGGGACCACACTAGGG - Intronic
1003653913 6:7987949-7987971 GTTCCTCAGAGACCAATGGCTGG - Intronic
1005280016 6:24262887-24262909 GGCCCACAGTGACCACTGCCTGG - Intronic
1005831233 6:29672730-29672752 GGGCCTTATGGATCACTGGAGGG - Exonic
1006388617 6:33746135-33746157 GGGCATCAGGGACCACCGTTTGG + Intronic
1006984759 6:38169101-38169123 GGTCCTCAGGGAGCACAGCCCGG - Exonic
1007413270 6:41677574-41677596 GGGGCTCAATCACCACTGGCGGG - Intergenic
1007727692 6:43926506-43926528 GAGCCCCAAGGACCACAGGCTGG - Intergenic
1007782485 6:44262631-44262653 GGGCCTCATGAATCACTGCCAGG + Exonic
1007786112 6:44280235-44280257 GGGATTCAGGGCCCGCTGGCGGG + Exonic
1009771193 6:68144893-68144915 GGCCTTCAGGGAACATTGGCTGG - Intergenic
1010950760 6:82034358-82034380 TGACCTCAGGGACCACTGATGGG - Intergenic
1014855521 6:126396338-126396360 GGCCCACAGGGAGCACTGCCTGG + Intergenic
1017599918 6:156069446-156069468 GGATCTCAGGGACCACCTGCAGG - Intergenic
1017777914 6:157694018-157694040 TGGCCTCGGGCAGCACTGGCAGG + Intergenic
1017820289 6:158044196-158044218 GGGCCCCAGTAGCCACTGGCTGG - Intronic
1019212371 6:170417176-170417198 TGGCCTCAGAAGCCACTGGCTGG - Intergenic
1019327508 7:445642-445664 GGGCCTCAGGGGCCTCTTGAGGG - Intergenic
1019800099 7:3082048-3082070 GTGTCTAAGGGATCACTGGCAGG + Intergenic
1023090695 7:36614912-36614934 GGGACCCATGGAACACTGGCAGG + Intronic
1024281740 7:47724429-47724451 AGGCCTAAAGGGCCACTGGCAGG + Intronic
1026258003 7:68729476-68729498 GGTCCACAGGGCCCACGGGCAGG + Intergenic
1026982754 7:74536283-74536305 GGGCCTCCGGGGCCAGGGGCGGG - Intronic
1028774745 7:94664180-94664202 GGGCCTCAGCGACCACATTCAGG + Exonic
1029444547 7:100604873-100604895 GGGCCGCAGGGCGCACTGGCGGG - Intronic
1029534040 7:101145366-101145388 GGGCCCCAGGGAAGACTTGCTGG - Intergenic
1029582624 7:101447572-101447594 GGGCCTCCCGGAGCCCTGGCTGG + Intronic
1029728467 7:102424258-102424280 GTGCCTCAAGGAGCATTGGCTGG + Intronic
1030102901 7:105962053-105962075 GGGACACAGGGGACACTGGCAGG + Intronic
1034444311 7:151104946-151104968 GGGCCCCAGGTGCCCCTGGCGGG + Intronic
1035602755 8:906409-906431 GGGCCTCAGGGATCAAGGCCAGG - Intergenic
1037457922 8:19082453-19082475 GAGCCTCAGAGAGCTCTGGCGGG + Intronic
1037645391 8:20788085-20788107 CTGCTTCAGGGACAACTGGCAGG + Intergenic
1037761332 8:21743690-21743712 TGGCCCCAGGGAGGACTGGCTGG + Intronic
1037994687 8:23343595-23343617 GGGCTTCAGGGTCCACAGCCAGG + Intronic
1038777682 8:30545807-30545829 GGGGCTCAGGCACCAAGGGCAGG - Intronic
1040485831 8:47870199-47870221 GGCCTTCAGTGACCACTGCCTGG - Intronic
1041168554 8:55116403-55116425 GGGCCTCAGGGGTCACTGTGAGG - Intronic
1041350430 8:56942812-56942834 GGCCCTCAGGGACCTGTGGTGGG - Intergenic
1041607023 8:59793376-59793398 GGCCCACAGTGACCACTGCCTGG - Intergenic
1042844705 8:73158453-73158475 GAGCCACAGGGGCCCCTGGCTGG - Intergenic
1043477065 8:80615538-80615560 GTGCATCAGGGACCTCTCGCTGG + Intergenic
1045504242 8:102767380-102767402 GGCCCACGTGGACCACTGGCTGG - Intergenic
1047212444 8:122850873-122850895 GGGCCTCAGGGGCTACTGGGAGG - Intronic
1049373717 8:142279440-142279462 TGGCCTCTGGGACCAGTGCCTGG - Intronic
1049398263 8:142411980-142412002 GGGCCTCAGGGGCCATGGGATGG + Intergenic
1049621922 8:143602331-143602353 GGGTCTCAGGGATCCATGGCTGG - Exonic
1049748787 8:144273972-144273994 GGGCTTCAGGGACCCCCTGCTGG - Intronic
1049805035 8:144534864-144534886 GGGACTCAGGGACCTCAGCCTGG + Intronic
1053140931 9:35682284-35682306 GGACCTCAGGGCCCCTTGGCAGG + Intronic
1053557692 9:39154828-39154850 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1053821806 9:41975116-41975138 GGGCCTCGGGGAGCACCTGCAGG + Intronic
1054139422 9:61464123-61464145 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1054608765 9:67212292-67212314 GGGCCTCGGGGAGCACCTGCAGG - Intergenic
1057198489 9:93128031-93128053 GGGCGTCAGGGGACACTGGTGGG + Intronic
1057440777 9:95081545-95081567 AGGCCTCAGGCCTCACTGGCTGG - Intronic
1057552612 9:96063254-96063276 GGGAGTCAGGGACCAAGGGCAGG - Intergenic
1057833135 9:98422327-98422349 GGGCCTCAGGCACTTCTGGTGGG + Intronic
1059803409 9:117773405-117773427 GGGGTTCAGGGATCACTGACTGG - Intergenic
1060789511 9:126476412-126476434 GGACTTCAGGGCCCACTGGGAGG + Intronic
1061045681 9:128163712-128163734 GGCCTTCAGGGACCCCTGGTGGG + Exonic
1061506826 9:131036353-131036375 GGGCATCAGGGACCCGAGGCTGG + Intronic
1061801275 9:133114593-133114615 GGGCCCCAGGGCACTCTGGCCGG + Intronic
1061909079 9:133713299-133713321 GGGGCTCAGAGAGCACGGGCAGG - Intronic
1061918288 9:133768640-133768662 GGGCCTCCTGGATCACTGGTTGG - Intronic
1062150648 9:135017128-135017150 GGGACTCAGGGACTGCTGGGTGG - Intergenic
1062508436 9:136890752-136890774 GGACCTCAGGGTCCCCTGACCGG + Intronic
1062635295 9:137487397-137487419 GGGGCTCATGGACCCCTGGAGGG + Intronic
1187691245 X:21869504-21869526 AGGCCTCTGGGTCCAATGGCAGG - Exonic
1187841550 X:23494062-23494084 GGGCCACAGGAACAGCTGGCAGG + Intergenic
1187889404 X:23920140-23920162 GGCCCACAGTGACCACTGCCTGG + Intronic
1189308525 X:40005041-40005063 GGGCCTCAAGTCCCACTGCCTGG + Intergenic
1193047274 X:77066534-77066556 AGGCCGCAGGGACCTCTGCCTGG + Intergenic
1196098848 X:111827863-111827885 GGGCCTCATGGACCGTTGGAAGG - Intronic
1196467853 X:115991414-115991436 GGGCTTAAGGGAACATTGGCTGG + Intergenic
1197016084 X:121627396-121627418 GGCCCACAGTGACCACTGACTGG - Intergenic
1197700547 X:129596347-129596369 GGGCCTGAGGAACCCCAGGCAGG + Intergenic
1198415178 X:136412679-136412701 GGGTCTCAGGGGCTTCTGGCTGG + Intronic
1200109677 X:153733943-153733965 AAGCCTCAGGGATCATTGGCTGG - Intronic
1200114524 X:153764378-153764400 GGGTCTCAGGGCCAACTGGCTGG + Intronic