ID: 1148844425

View in Genome Browser
Species Human (GRCh38)
Location 17:50520775-50520797
Sequence ATATGCACAGGGTTGTGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148844413_1148844425 25 Left 1148844413 17:50520727-50520749 CCCCAGAGTGGTTGAACCCCTCT 0: 1
1: 0
2: 0
3: 6
4: 98
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844418_1148844425 8 Left 1148844418 17:50520744-50520766 CCCTCTGGCCTGTAGTTTCCTCA 0: 1
1: 1
2: 4
3: 53
4: 430
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844420_1148844425 0 Left 1148844420 17:50520752-50520774 CCTGTAGTTTCCTCATCTGTAAA 0: 2
1: 4
2: 139
3: 578
4: 1447
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844414_1148844425 24 Left 1148844414 17:50520728-50520750 CCCAGAGTGGTTGAACCCCTCTG 0: 1
1: 0
2: 0
3: 6
4: 89
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844419_1148844425 7 Left 1148844419 17:50520745-50520767 CCTCTGGCCTGTAGTTTCCTCAT 0: 1
1: 1
2: 4
3: 47
4: 443
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844415_1148844425 23 Left 1148844415 17:50520729-50520751 CCAGAGTGGTTGAACCCCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 58
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844417_1148844425 9 Left 1148844417 17:50520743-50520765 CCCCTCTGGCCTGTAGTTTCCTC 0: 1
1: 1
2: 20
3: 205
4: 1321
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245
1148844421_1148844425 -10 Left 1148844421 17:50520762-50520784 CCTCATCTGTAAAATATGCACAG 0: 1
1: 1
2: 25
3: 302
4: 1551
Right 1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG 0: 1
1: 0
2: 1
3: 14
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148844425 Original CRISPR ATATGCACAGGGTTGTGATA GGG Intronic
901415740 1:9114730-9114752 ATAGGCAGAGGGTTTTGAAAGGG + Intronic
901688567 1:10958257-10958279 ATATTCAAAGGGATGTGAAATGG + Intronic
901929708 1:12589209-12589231 AAATAGACAGGGTTGTGAAAGGG - Intronic
903469769 1:23578215-23578237 AAATGCAAATGCTTGTGATACGG + Intergenic
904705247 1:32385388-32385410 ACATGCACAGGTTTGTTACATGG - Intronic
905003140 1:34689059-34689081 ATAAGCACAGGTTTGAGAGATGG + Intergenic
905058938 1:35122645-35122667 ACATGCACAGTTTTGTGATGTGG + Intergenic
905219360 1:36433608-36433630 ACATGCACAGGTTTGTTACATGG - Intronic
906555199 1:46705529-46705551 ACATGCACAGTTTTGTGATGTGG - Intronic
906916607 1:50017846-50017868 ACATACACAGGTTTGTTATATGG - Intronic
907197190 1:52696535-52696557 ATATGTATATGGTTGTGTTATGG + Intronic
907591358 1:55675324-55675346 ACATGCACAGGTTTGTTACAGGG + Intergenic
909466176 1:75976648-75976670 AAATGCACAGGTCTGTGATGTGG - Intergenic
912061238 1:105673850-105673872 ACATGCACAGGTTTGTTACATGG + Intergenic
916706824 1:167359230-167359252 AAATGCACAGGTTTGTTACATGG + Intronic
916984695 1:170178295-170178317 ATATGTGCAGGTTTGTTATATGG + Intergenic
917026316 1:170646424-170646446 ATGTGCACAGCTTTGGGATATGG + Intergenic
918645366 1:186897840-186897862 ACATGTACAGGTTTGTTATATGG + Intronic
919479469 1:198069745-198069767 ATATGTCCAGGTTTGTTATATGG + Intergenic
921758909 1:218889640-218889662 ATCAGCACAGGGTTGGGATTTGG - Intergenic
922394327 1:225180855-225180877 ACATGTACAGGTTTGTGACATGG + Intronic
922426494 1:225501034-225501056 ATTGGCACTGGGCTGTGATAAGG + Exonic
923024027 1:230190087-230190109 ATCTGCACAGTGTTGTCATAAGG + Intronic
923228473 1:231961416-231961438 ATATGTATAGGTTTGTTATATGG + Intronic
923945955 1:238887808-238887830 ATATGCACAGGCTTGTCAACTGG - Intergenic
924413760 1:243835440-243835462 ACATGTACAGGTTTGTTATATGG - Intronic
1064437975 10:15327892-15327914 ACATGTACAGGTTTGTGATATGG - Intronic
1065838387 10:29679840-29679862 ACATGTACAGGTTTGTGACATGG - Intronic
1065889008 10:30104682-30104704 ATATGCACAGGTTTGTTACATGG - Intronic
1067154621 10:43767530-43767552 ATAGGCACAATGTTGTGAAAGGG - Intergenic
1067175857 10:43944961-43944983 GTGTGCACAGGGATGTGACATGG + Intergenic
1068794240 10:61060525-61060547 ATATGCGCAGGTTTGTTACATGG + Intergenic
1068858661 10:61824024-61824046 ATATTCACAGGGTTAAGATGTGG - Intergenic
1069068475 10:63970626-63970648 ATATGTGCAGGTTTGTTATATGG - Intergenic
1069145130 10:64882578-64882600 ACATGTACAGGTTTGTTATAAGG - Intergenic
1069283327 10:66682705-66682727 ACATGTACAGGTTTGTTATATGG + Intronic
1070982544 10:80661004-80661026 ACAGGCACAGAGTTGTGAAAAGG + Intergenic
1071362012 10:84857339-84857361 CTATGCACAGGGTTTTTATCAGG + Intergenic
1073093782 10:100967882-100967904 TTATGCACAGGCTTGTGTTGGGG - Intergenic
1073823806 10:107296319-107296341 ACATGTACAGGGTTGTTACATGG - Intergenic
1074167353 10:110895104-110895126 ATATGTACAGGTTTGTTAGATGG + Intronic
1074187574 10:111110196-111110218 ATATGTGCAGGTTTGTTATATGG + Intergenic
1076498587 10:130916246-130916268 AAATGCACAGGGCTGTTGTATGG - Intergenic
1076654083 10:132010046-132010068 ATAAAGAAAGGGTTGTGATATGG + Intergenic
1077032496 11:475153-475175 ATATTCACGCGTTTGTGATACGG + Intronic
1077032500 11:475255-475277 ATATTCACGCGTTTGTGATACGG + Intronic
1077951723 11:6966440-6966462 ATATGTACAGGTTTGTTACATGG - Intronic
1078009452 11:7560943-7560965 ATAGGCACAAGGTTCTTATATGG - Intronic
1079302701 11:19293169-19293191 ACATGTACAGGTTTGTTATATGG + Intergenic
1080216238 11:29844528-29844550 ATATGCAGAGTGATGTGATAGGG + Intergenic
1080338529 11:31229000-31229022 ATATGTACAGGTCTGTTATATGG - Intronic
1080714032 11:34780977-34780999 ACATGCACAGGTTTGTTACATGG + Intergenic
1082749836 11:57003580-57003602 TCATGCACAGGTTTGTTATATGG - Intergenic
1085918969 11:80928597-80928619 ATTTGCACAGGTTTGTTACATGG + Intergenic
1086041730 11:82487340-82487362 ATATACACAGGTTTGTTACATGG + Intergenic
1086912176 11:92485877-92485899 AGATTCACAGAGTTTTGATAAGG - Intronic
1087522804 11:99263902-99263924 ATATGCACAGGATTTTGCTTCGG - Intronic
1087560940 11:99789804-99789826 ATATGCGCAGGTTTGTTACATGG + Intronic
1094128798 12:27052631-27052653 ATATGTACAGGTTTGTTACATGG + Intronic
1094156178 12:27338988-27339010 ATATGTGCAGGTTTGTTATATGG + Intronic
1096235945 12:49926531-49926553 ATATGTGCAGGTTTGTTATAAGG + Intergenic
1097285590 12:57874611-57874633 ATATGCCCAGAGTTGTGATAGGG + Intergenic
1099404159 12:82239550-82239572 ATATACACAGGTTTGTTACATGG + Intronic
1099662864 12:85587660-85587682 ACATACACAGGTTTGTTATACGG - Intergenic
1101247124 12:102894327-102894349 ATATGTACAGGTTTGTTACACGG - Intronic
1101582901 12:106059463-106059485 ATATGCAAAGGGTAGGCATACGG + Intergenic
1102066935 12:109984747-109984769 CTATTCACAGGGTTATTATAAGG + Intronic
1102735419 12:115154792-115154814 ATATGTGCAGGTTTGTTATATGG + Intergenic
1103118700 12:118361816-118361838 ACATGCACAGGTTTGTTACATGG + Intronic
1104299293 12:127549668-127549690 ATATGTACAGGTTTGTTACATGG + Intergenic
1107158237 13:37195168-37195190 ATATGTACAGGTTTGTTACATGG + Intergenic
1107839914 13:44446597-44446619 ACAGGCACAGGTTTGTAATATGG - Intronic
1109009031 13:56915853-56915875 AAGTGCACAGAGTTGTGAAAAGG - Intergenic
1109302555 13:60604296-60604318 ATATGCACAGGTTTGTTACCTGG - Intergenic
1109961922 13:69643085-69643107 ATATGCAATGGGTTGTAAAATGG - Intergenic
1110400410 13:75083657-75083679 ATCAGAACAGGGTTGTTATAAGG + Intergenic
1111495441 13:89042912-89042934 ATATGCACAGTTTTGTGATGTGG + Intergenic
1113856171 13:113446498-113446520 ACATGCACGGTGTTGTCATATGG + Intronic
1115405545 14:33011439-33011461 ATGTGCACAGCCTTGGGATATGG + Intronic
1115915818 14:38312796-38312818 ATATGTACAGGTTTGTTACATGG + Intergenic
1116766860 14:49083135-49083157 ATATGTGCAGGTTTGTTATATGG - Intergenic
1118089609 14:62458808-62458830 ATGTGCACAGGGTTTTGTTTTGG - Intergenic
1118652754 14:67915189-67915211 AAATGCACAGGTTTGTTACAAGG - Intronic
1119607054 14:76028497-76028519 ATATGCGCAGGTTTGTTACAGGG + Intronic
1120072657 14:80121379-80121401 ATCTGCACAGACTTCTGATATGG + Intergenic
1120275193 14:82364377-82364399 TTATGCACAGTTTTGTTATATGG + Intergenic
1121725415 14:96144757-96144779 ACATGTACAGGTTTGTTATATGG - Intergenic
1122057441 14:99112564-99112586 AATTGAACATGGTTGTGATAAGG - Intergenic
1122766929 14:104078955-104078977 ATATTCACATTGTTGTGAAAGGG + Intergenic
1125032437 15:35086032-35086054 ATATGCATATGGTTGTGTTCTGG - Intergenic
1125285162 15:38084699-38084721 ATATGCCAAGGTTTGTGCTAGGG - Intergenic
1126467171 15:48971906-48971928 ACATGTGCAGGGTTGTTATAAGG - Intergenic
1127519530 15:59729589-59729611 ATATGCACTGTTTTGTGAGATGG + Intergenic
1127831741 15:62757106-62757128 ATAAGCACAGGGTGGTTGTATGG - Intronic
1129028712 15:72603723-72603745 GTATGCACATGGTTCTGAGAAGG - Intergenic
1129552136 15:76464087-76464109 ATATGCACATTGTTGTAAAATGG + Intronic
1134389751 16:13808468-13808490 ATATGTACATGTTTGTTATATGG + Intergenic
1135677779 16:24431713-24431735 ACATGCACAGGTTTGTTAAATGG - Intergenic
1139010659 16:62629037-62629059 ACATGCACAGGTTTGTTACATGG + Intergenic
1140042111 16:71415029-71415051 ATATGCAAAGTGTTTTAATATGG - Intergenic
1142578878 17:928067-928089 TAATTCACAGGGTTGTGGTAAGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1145839688 17:27984143-27984165 ATATGTACAGAGCTGAGATAGGG + Intergenic
1148844425 17:50520775-50520797 ATATGCACAGGGTTGTGATAGGG + Intronic
1149336540 17:55641847-55641869 ATATGCACAGCTTTGTGAGTGGG + Intergenic
1150044085 17:61894120-61894142 ACATACACAGTGGTGTGATAAGG + Intronic
1151000818 17:70373894-70373916 ATATGTGCAGGTTTGTTATATGG - Intergenic
1153411718 18:4800685-4800707 ATATGCCCAACATTGTGATAGGG + Intergenic
1153531373 18:6049829-6049851 ACATGTACAGGTTTGTTATACGG - Intronic
1159350326 18:67264344-67264366 ACATGTGCAGGGTTGTTATACGG - Intergenic
1160287147 18:77554265-77554287 ATATGCACCTGGCTGTGACAAGG - Intergenic
1163507880 19:17719155-17719177 ATAGGCACCGGGTTCTGATGCGG + Intergenic
1164069936 19:21758386-21758408 ACATGTGCAGGGTTGTTATATGG - Intronic
1164889050 19:31807401-31807423 GTATGCATAGGGTTGGGAGAGGG - Intergenic
1167687864 19:50967958-50967980 ATATGCACAGGGTTGGGGTGGGG - Intronic
1168097900 19:54125873-54125895 ATATGCCCAGGGCTGTGAGGCGG - Intronic
926925027 2:17978629-17978651 TTATACACAGGGCTGTGACATGG - Intronic
927449205 2:23192166-23192188 ATTTGCACATGGTTTGGATATGG + Intergenic
929189062 2:39122856-39122878 ATATTTAAAGGGTTGTGATATGG + Intronic
929432107 2:41895925-41895947 AGATGCAGAGGGCTGGGATATGG - Intergenic
930104955 2:47632327-47632349 CTTTGCAAAGGGTGGTGATAAGG - Intergenic
930340772 2:50111713-50111735 ATATTCAAAGGGCTGTGATTTGG - Intronic
931390166 2:61834770-61834792 ATATGCGCAGGTTTGTTACAAGG - Intronic
931461045 2:62450436-62450458 GTATGCACATGTATGTGATAAGG + Intergenic
933579893 2:84113665-84113687 ATATGCGCAGGTCTGTTATATGG + Intergenic
935444456 2:103141395-103141417 ATGTACACAGGGTTGTGAGCAGG - Intergenic
935859025 2:107307549-107307571 ATATGCTGAGGGTGGTGATGGGG - Intergenic
935897369 2:107752294-107752316 ATTTGGAAAGGGTTATGATAAGG + Intergenic
940681926 2:156796833-156796855 ATAGTCACAGGGTTGTTATGAGG + Intergenic
940778272 2:157906716-157906738 ATATGCCCAGGGAAATGATAGGG + Intronic
941194683 2:162434343-162434365 ATGTGCACAGGTTTGTTACATGG - Intronic
942886448 2:180930699-180930721 ACATGTACAGGTTTGTTATATGG + Intergenic
943180473 2:184534493-184534515 ATATGCGCAGGTTTGTTACATGG - Intergenic
943217444 2:185056975-185056997 GTATGTACAGGTTTGTTATAAGG - Intergenic
943801379 2:192062158-192062180 ATATAGACAGGGTAGTGGTAGGG - Intronic
944903626 2:204240858-204240880 AAATGAACATGGTTGTGCTAGGG - Intergenic
944952817 2:204771629-204771651 ATATGTGCAGGTTTGTTATATGG - Intronic
945619257 2:212112689-212112711 TTATTCATAGGGTTGTAATAAGG + Intronic
946135082 2:217639350-217639372 AAATGTACAGGTTTGTTATATGG - Intronic
948366705 2:237459915-237459937 TTAGGCACAGTGTTGTGAAAAGG - Intergenic
1169621305 20:7509404-7509426 ACATGTACAGGTTTGTTATAAGG - Intergenic
1169839022 20:9913845-9913867 ACATGCACAGGTTTGTTATCTGG + Intergenic
1170544958 20:17427984-17428006 AAAAGCCCAGGGTTGTGAGAAGG + Intronic
1172056476 20:32157890-32157912 GTGCGCACAGGGTTGTCATATGG - Exonic
1177448194 21:21226268-21226290 ATATGTGCAGGTTTGTTATATGG - Intronic
1177569031 21:22862130-22862152 ATATGGAGAGGGTTATAATATGG - Intergenic
1177756487 21:25354838-25354860 ATATGTACAGGTTTGTTACATGG - Intergenic
1177807118 21:25885336-25885358 GTCTGCACAGGGTCGTGGTAGGG - Intronic
1185173023 22:49304470-49304492 ATCTGCACAGTGTGGTGATTGGG - Intergenic
950943492 3:16919345-16919367 ATATGCAGTGGGTTGTAAAAAGG - Intronic
953543683 3:43844316-43844338 ATATGTGCAGGTTTGTTATATGG + Intergenic
954078679 3:48199640-48199662 AGATGAAGAGGGTTGTGGTAGGG - Intergenic
956477880 3:69642481-69642503 ATATGTGCAGGTTTGTTATATGG - Intergenic
956948033 3:74246227-74246249 ATTTGCAGTGGGTTGTGACAGGG + Intergenic
957141607 3:76366056-76366078 ATATGCAAAGGGCTGAGAAATGG - Intronic
957377175 3:79372936-79372958 ACATGCGCAGGTTTGTTATATGG + Intronic
960723472 3:120647285-120647307 ATATGCACAATTTTGTGACATGG + Intronic
961179384 3:124864698-124864720 ATATGTGCAGGTTTGTTATATGG - Intronic
963840472 3:150099855-150099877 ATATTCACATTGTTGTGAAATGG + Intergenic
964147302 3:153480356-153480378 AACTGCACAGGGTTGTGCTGAGG - Intergenic
964252010 3:154728638-154728660 ATATGTGCATGGTTGTTATATGG - Intergenic
964584986 3:158287913-158287935 ATATGCACAAAGTTGCCATATGG - Intronic
964923034 3:161921012-161921034 ATATACACAGGTTTGTTACATGG - Intergenic
964928840 3:161990688-161990710 ATAAGCACAGGGCTGTGGGAAGG - Intergenic
965109926 3:164407796-164407818 ATCTGCACAGGGTTCTGTTGAGG - Intergenic
966024832 3:175264918-175264940 ATATTCACAATTTTGTGATATGG - Intronic
966442700 3:179963987-179964009 ACATGTACAGGTTTGTTATATGG + Intronic
969878359 4:10152808-10152830 ATATGCACAGGTCAGTGACAGGG + Intergenic
970170539 4:13284843-13284865 ACATGCACAGGTTTGTTACATGG + Intergenic
971135928 4:23868507-23868529 ATGTGCACAGCTTTGTGCTAGGG + Intronic
971779721 4:31017330-31017352 TGATGCACAGCATTGTGATAAGG + Intronic
972903385 4:43713077-43713099 ATAATCACAGAGTTGTCATAGGG + Intergenic
976421972 4:84855336-84855358 CTATGCACAGTTTAGTGATAGGG - Intronic
976917138 4:90390320-90390342 ACATGCACAGGTTTGTTACATGG + Intronic
978402789 4:108348892-108348914 ACATGCACAGGTTTGTTACATGG + Intergenic
979201334 4:117982630-117982652 ACATGCACAGGTTTGTTACATGG - Intergenic
979604408 4:122622693-122622715 CTACTCATAGGGTTGTGATAAGG + Intergenic
980844734 4:138311054-138311076 TTATGCACAGCATTGTGATGAGG + Intergenic
980973629 4:139589605-139589627 TTAAACACAGGGTGGTGATAGGG + Intronic
981444773 4:144823017-144823039 ATATGTGCAGGTTTGTTATATGG + Intergenic
981779656 4:148412766-148412788 ATATTCACAGTGTTGTGGTCTGG - Intronic
982049665 4:151488203-151488225 ATATGTGCAGGTTTGTTATATGG + Intronic
982076375 4:151741433-151741455 ATATGCACATGGATGAGATATGG - Intronic
984831266 4:183976669-183976691 ATATGCACAAGTTTGTTACATGG - Intronic
988134151 5:27147541-27147563 CTATGCACATAGTTGTTATAAGG + Intergenic
988653090 5:33175238-33175260 GTAGGCACAGGCTTTTGATATGG - Intergenic
995387706 5:111606696-111606718 ATATGTACAGGTTTGTTATATGG + Intergenic
997332871 5:133079200-133079222 AAATTCACAGGGTTGTGCAATGG + Intronic
997668831 5:135653898-135653920 ATATACTCAGGGTTCTCATAGGG + Intergenic
999073903 5:148777020-148777042 ATATGCACATGTTTGAGATGTGG + Intergenic
1000025457 5:157355045-157355067 ATAACAACAGGGTTGTTATAAGG - Intronic
1001649653 5:173306602-173306624 ATATTCACACGGGTGTAATAAGG - Intergenic
1004076679 6:12350321-12350343 ATATGTGCAGGTTTGTTATATGG + Intergenic
1004599907 6:17138982-17139004 ACATGCACAGGTTTGTTACATGG - Intergenic
1005279088 6:24251894-24251916 ATGTGCACAGGGATTTGATGTGG - Intronic
1007871408 6:45043350-45043372 ATATGTACAGGTTTGTTACATGG + Intronic
1009682201 6:66910329-66910351 ACATGTACAGGTTTGTTATATGG + Intergenic
1012648736 6:101724222-101724244 ACATGGACAGGTTTGTTATATGG + Intronic
1013266041 6:108499828-108499850 ACATGCACAGGTTTGTTACATGG + Intronic
1013621287 6:111891986-111892008 ATATGTGCAGGTTTGTTATATGG + Intergenic
1013819792 6:114140929-114140951 ATACCCACAAGGTTGTTATAAGG + Intronic
1014412710 6:121146847-121146869 ATATGTACAGGGTTGCTATATGG + Intronic
1014459349 6:121677112-121677134 ATCTTCACAGTGTTGTGAGAGGG - Intergenic
1017296514 6:152802137-152802159 ATATGTGCAGGGTTGTTACATGG + Intergenic
1017557840 6:155591818-155591840 ATATCCAAAAGGTTGAGATAAGG + Intergenic
1019081834 6:169437936-169437958 ATATGTTCAGGTTTGTTATATGG + Intergenic
1020463462 7:8449546-8449568 ATATGCTCATGCTAGTGATATGG + Intronic
1020665965 7:11044274-11044296 ATATGCACAGGTTTGTTACATGG - Intronic
1020706646 7:11552275-11552297 ATATGTACAGGTTTGTTACATGG - Intronic
1021296160 7:18908912-18908934 ATATACACACAGTTGTGAGATGG + Intronic
1022117210 7:27272415-27272437 ACAGGCACAGGGTTGTGTGAGGG + Intergenic
1023300640 7:38767012-38767034 CCATGCAGTGGGTTGTGATACGG - Intronic
1023325388 7:39050192-39050214 ATATGAACAAGGTTGTGGCAAGG - Intronic
1027928637 7:84501006-84501028 ACATGCACAGGTTTGTTACATGG + Intergenic
1031356635 7:120794898-120794920 ATATGCTCAGGGTTATGTTCAGG - Intronic
1031792841 7:126132045-126132067 ATATGCACAGGTTTGTCAAGGGG + Intergenic
1036035788 8:5017674-5017696 ATGACCACAGGGTTGTGAGATGG + Intergenic
1037166098 8:15830866-15830888 ACATGCACAGGTTTGTTATATGG - Intergenic
1040947601 8:52900534-52900556 ACATGCACAGGTTTGTTACATGG + Intergenic
1040973294 8:53161454-53161476 ACATGTACAGGTTTGTTATATGG + Intergenic
1041007249 8:53507665-53507687 ATATGCACAGGGTTATGGGGAGG - Intergenic
1043013474 8:74909236-74909258 AGATGTACAGGTTTGTTATATGG + Intergenic
1051947811 9:22592973-22592995 AGATGCAGAGGGTGGTGGTAAGG - Intergenic
1052607056 9:30717956-30717978 AGATGCACAGGTTTGTTATATGG + Intergenic
1056776118 9:89514129-89514151 ATATGGACAGGGTTTTGGTGTGG + Intergenic
1056959169 9:91106418-91106440 AAATGCACGCGGTGGTGATAGGG - Intergenic
1057029455 9:91763286-91763308 ACATGTACAGGTTTGTGACATGG - Intronic
1057629142 9:96705881-96705903 AGATGCACAGGGATGTGAGGGGG - Intergenic
1060966403 9:127714569-127714591 AGATGGTCAGGGTTGGGATAGGG - Intronic
1061065988 9:128277687-128277709 GTATGCACATGGTTCTGAGATGG + Intronic
1186101552 X:6162865-6162887 ATATGCATATGTATGTGATATGG + Intronic
1186662556 X:11683709-11683731 ACATGTGCAGGGTTGTGACATGG - Intergenic
1187880785 X:23845424-23845446 ATAGGCACAGTGTTGTGCAAGGG + Intronic
1188356716 X:29200856-29200878 ATATGTACAGGTTTGTTACATGG + Intronic
1188759250 X:34005311-34005333 ATATGTACAGGTTTGTTACATGG + Intergenic
1189124632 X:38433384-38433406 AGATACACAGAGTTGTGATGTGG - Intronic
1189917130 X:45866543-45866565 ATATGCACAGCTTTGGGATATGG - Intergenic
1190364512 X:49678830-49678852 ATGTGCACAGCTTTGGGATATGG + Intergenic
1190557694 X:51652836-51652858 ACATGCACAAGTTTGTTATATGG + Intergenic
1190873503 X:54444247-54444269 AGATTCACAGGGAAGTGATAAGG + Intronic
1190949157 X:55125297-55125319 CAATGCACAGGGATGTGTTAAGG + Intronic
1192017325 X:67345785-67345807 ATATGGAGAGGGGTGTGATTGGG - Intergenic
1192988360 X:76424902-76424924 ACATACACAGGTTTGTTATATGG - Intergenic
1193266536 X:79478085-79478107 ATATGTACAGGTTTGTTACATGG + Intergenic
1193670795 X:84383617-84383639 ACATGCACAGGTTTGTTACATGG + Intronic
1194904064 X:99551596-99551618 ACATGCACAGGTTTGTTACAAGG + Intergenic
1195255601 X:103086393-103086415 ATTTACACTGGATTGTGATAGGG + Intronic
1195367330 X:104138947-104138969 ATAGGCACAGGATGGTGGTATGG + Intronic
1197417867 X:126197197-126197219 ACATGTGCAGGGTTGTTATATGG - Intergenic
1197934051 X:131722481-131722503 ATTAAGACAGGGTTGTGATACGG + Intergenic
1198280797 X:135140122-135140144 ACATGCACAAGTTTGTTATATGG + Intergenic
1198290162 X:135232392-135232414 ACATGCACAAGTTTGTTATATGG - Intergenic
1198741613 X:139849046-139849068 ATATAGAGAGGATTGTGATAGGG - Intronic
1199310701 X:146316587-146316609 ACATGTACAGGGTTGTTACATGG - Intergenic
1200014058 X:153145770-153145792 ATATGTGCAGGTTTGTTATAGGG - Intergenic
1200025542 X:153254183-153254205 ATATGTGCAGGTTTGTTATAGGG + Intergenic
1200090583 X:153634093-153634115 ATGAGCACAGGGTTGTGCGAGGG - Intergenic
1200240854 X:154492726-154492748 ATATGCTGAGGGTTGTTACAAGG + Intergenic
1200343071 X:155419993-155420015 AAATGCACATGATTGTGAAATGG + Intergenic
1200585206 Y:4999880-4999902 GTATGCACAGGGTTTTGCTCAGG + Intergenic
1200888182 Y:8293219-8293241 ATATGCATATGTTTGTGATTTGG + Intergenic