ID: 1148844462

View in Genome Browser
Species Human (GRCh38)
Location 17:50521088-50521110
Sequence GGGTCCTTGGACCTCATGCT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148844453_1148844462 24 Left 1148844453 17:50521041-50521063 CCTTGAGAAGTGGGTGAGCAAGG 0: 1
1: 0
2: 1
3: 17
4: 208
Right 1148844462 17:50521088-50521110 GGGTCCTTGGACCTCATGCTAGG 0: 1
1: 0
2: 3
3: 15
4: 134
1148844452_1148844462 25 Left 1148844452 17:50521040-50521062 CCCTTGAGAAGTGGGTGAGCAAG 0: 1
1: 0
2: 1
3: 11
4: 197
Right 1148844462 17:50521088-50521110 GGGTCCTTGGACCTCATGCTAGG 0: 1
1: 0
2: 3
3: 15
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148844462 Original CRISPR GGGTCCTTGGACCTCATGCT AGG Exonic
901405355 1:9041417-9041439 GGGTCCTATGAACTGATGCTGGG + Intronic
902605938 1:17569399-17569421 GGGTCCTGGGGCTCCATGCTGGG + Intronic
902830355 1:19008416-19008438 TCGTCCTAGGACCTCAAGCTTGG + Intergenic
911058100 1:93724634-93724656 GAGTCCTTGGACACCAGGCTGGG - Intronic
913071035 1:115298720-115298742 TGGTCCTTGGACTTAATGATAGG + Intronic
913669233 1:121080150-121080172 GGGTTCTTGGATCTCATGCAAGG + Intergenic
914020983 1:143867545-143867567 GGGTTCTTGGATCTCATGCAAGG + Intergenic
914659478 1:149775473-149775495 GGGTTCTTGGATCTCATGCAAGG + Intergenic
915899941 1:159839733-159839755 GGTGCCTTTGAGCTCATGCTAGG - Intronic
917662164 1:177187342-177187364 TGGTCCTTGGTCTTCATCCTTGG + Intronic
917692047 1:177479682-177479704 AGGCCCTTGGACCTCATGGAAGG + Intergenic
924090011 1:240492492-240492514 TGGTCCCTGGACCTCTGGCTGGG - Exonic
1063009938 10:2012065-2012087 GGGTCCTTTCTCCTCATGCTCGG - Intergenic
1063046278 10:2396358-2396380 GGGTCCTTAGCCCTGATGGTTGG - Intergenic
1064745681 10:18475910-18475932 GGGTTCTTGGACCTTGTGCAAGG + Intronic
1065389556 10:25168653-25168675 GGGCCCTTGAACCACTTGCTGGG + Intergenic
1065889311 10:30107692-30107714 GGGTTCTTGGACCTCATGCAAGG - Intronic
1072517608 10:96201189-96201211 GGGTCCTTGGACCACACTTTTGG - Intronic
1075728179 10:124621207-124621229 GGGTCCTGGCACCACATGCCCGG - Exonic
1076195249 10:128513081-128513103 GGGTGCTTGCAGCTCATGCGGGG + Intergenic
1077415614 11:2423016-2423038 GGGGCCTTGGACATCCTGCATGG + Exonic
1077462709 11:2718574-2718596 GGCTCCTTGGAGCACATGCATGG + Intronic
1080599791 11:33810164-33810186 GAGTCCTTGTTCCTGATGCTGGG + Intergenic
1081291677 11:41334047-41334069 GTGTCCTTACACCTCATGATTGG - Intronic
1084475262 11:69385226-69385248 GGGCCCTTGGTCCTCCTGCATGG + Intergenic
1089467008 11:118691936-118691958 GGGCTCTTGGACCTCAGGCCAGG + Intergenic
1095819890 12:46466458-46466480 GGGTCCTGGGACGTGGTGCTAGG + Intergenic
1099975652 12:89543067-89543089 GGGTCCTGGGACGTCATGGAAGG + Intergenic
1101981292 12:109409132-109409154 GGGTACTTGGTCCTCTTACTTGG + Intronic
1102886262 12:116524417-116524439 GGGTCCGAGGACTTCATGTTAGG + Intergenic
1103144412 12:118582237-118582259 GGGTTCTTGGCTCTCATGCAAGG + Intergenic
1103201974 12:119095197-119095219 GGCTCCTGGGACCTCAGTCTGGG - Intronic
1104914911 12:132259683-132259705 GTGACCTTGGGCCTCCTGCTGGG - Intronic
1109192766 13:59345364-59345386 GTGTCCTTGGATGTCTTGCTGGG + Intergenic
1109610412 13:64757831-64757853 GGGTTCTTGGATCTCAGGCAAGG + Intergenic
1109951892 13:69510780-69510802 GGGCCCATGGTCCCCATGCTGGG + Intergenic
1112265345 13:97918698-97918720 CAGTCCTTGGACCTCATCCCAGG - Intergenic
1112735313 13:102409480-102409502 GGGTCCTCTGAACTCTTGCTGGG - Intergenic
1117100002 14:52335838-52335860 GGGTCCTGACAGCTCATGCTAGG - Intergenic
1120709880 14:87781866-87781888 GGGTCCTTTGTCTTCTTGCTTGG + Intergenic
1120874537 14:89363293-89363315 GGGAACTTGGACCCCATGCAGGG - Intronic
1123467380 15:20527031-20527053 GGGTCCTTGGAATTCATGTGGGG - Intergenic
1124575056 15:30900715-30900737 GTGTCCTTTCACCTCATTCTAGG - Intergenic
1128254004 15:66184060-66184082 GGGTGCCTGGACATCAGGCTGGG + Intronic
1128678478 15:69629011-69629033 AGGTCCCTGGCTCTCATGCTAGG + Intergenic
1132503680 16:296445-296467 GGGCCCCTGGCCCTCCTGCTGGG + Intronic
1132756472 16:1487723-1487745 CGGGCCTTGGACCTCACCCTGGG - Exonic
1132986082 16:2768373-2768395 GGGACCTTGACCCTCAAGCTGGG + Intronic
1133036885 16:3038567-3038589 GGGTCCGTGCACCTCTGGCTGGG + Intergenic
1135303524 16:21350407-21350429 GGCTCCCGGGAGCTCATGCTGGG + Intergenic
1136013588 16:27381052-27381074 GGGTCCTTGGGCCACATGTGGGG - Intergenic
1138030258 16:53554135-53554157 GGGTACTTGGAACTCAGGTTTGG + Intergenic
1142061999 16:88036365-88036387 GCCTCCTGGGAGCTCATGCTGGG + Intronic
1142131403 16:88433135-88433157 GGGTCCTGGGACCTCCTGCTAGG - Exonic
1143866154 17:9925594-9925616 GTGTCCTTGGACCCCAGGCCCGG - Exonic
1146299781 17:31678897-31678919 GGGGCCCTGGACCTGCTGCTAGG + Intergenic
1146691779 17:34881894-34881916 GGCTACTTGGAACTCATTCTAGG + Intergenic
1146726903 17:35163833-35163855 GGGTCCTTTGACCCCATTCTAGG + Intronic
1148844462 17:50521088-50521110 GGGTCCTTGGACCTCATGCTAGG + Exonic
1150457009 17:65314250-65314272 GGGTCCCTGAACCTGCTGCTAGG + Intergenic
1150866080 17:68851615-68851637 AGGTCCTTGGTCATGATGCTGGG + Intergenic
1152572971 17:81128556-81128578 GGGTCCCTGAACCCCCTGCTTGG - Intronic
1153741935 18:8138406-8138428 GTGTCCTTGGAACTCCTGGTTGG + Intronic
1154970535 18:21404216-21404238 GGAGCCTAGGACCTCATTCTAGG + Intronic
1155408096 18:25512488-25512510 GGGTCATTGGAATTGATGCTAGG - Intergenic
1155850668 18:30769983-30770005 GGGTTCTTGGATCTCAAGCAAGG - Intergenic
1157330980 18:46703636-46703658 GGGTCCCTGGCCCTCAGGCAGGG - Intronic
1158453710 18:57588457-57588479 GGGTGCTGGGCCCTCCTGCTGGG + Intergenic
1160272795 18:77403307-77403329 GCGTGGTAGGACCTCATGCTGGG + Intergenic
1160795841 19:945085-945107 GGGCCCTTGGACCTGGTTCTTGG + Intronic
1161464768 19:4422800-4422822 GTGTCCTTGGAGGCCATGCTGGG + Intronic
1161907297 19:7166306-7166328 GGGTCGTTGGACCTCAGGGGTGG + Exonic
1162586028 19:11559077-11559099 GGCTCCTGGGACCTCGAGCTTGG - Intronic
1166747002 19:45146211-45146233 GGGTCCTGGGAGCTCTTCCTGGG + Intronic
1167265081 19:48479082-48479104 GACTCCTTGGCCCTCATCCTGGG + Intronic
1167948228 19:53006512-53006534 GGGTTCTTGGATCTCACGCAAGG + Intergenic
925726259 2:6875438-6875460 GGGTCCATGGAAAGCATGCTGGG - Intronic
932436070 2:71703186-71703208 AAGTGGTTGGACCTCATGCTTGG + Intergenic
937252375 2:120533170-120533192 AAGTCTTTGGACCTCATTCTGGG + Intergenic
937364747 2:121253530-121253552 TGGACATTGGGCCTCATGCTAGG - Intronic
938243028 2:129757713-129757735 TGTTCCTTGAACCACATGCTGGG + Intergenic
942267432 2:174242478-174242500 GGGTTCCCGAACCTCATGCTGGG - Intronic
1169945050 20:10979166-10979188 GGGTCCTTGGACATCCTGGCTGG - Intergenic
1172972065 20:38881039-38881061 GGCTCCTGGGACCTGAGGCTTGG + Intronic
1174275220 20:49398766-49398788 GGGTCCCAGGACCTGGTGCTTGG - Intronic
1175914379 20:62418936-62418958 GGGTCCTTGGACCTCCAGGTGGG + Intronic
1178669819 21:34580593-34580615 GGCTCCTTGGAGCTGAAGCTGGG + Intronic
1179322261 21:40303278-40303300 GGCACCTTGGGCCTCTTGCTGGG + Intronic
1179394704 21:41028143-41028165 GGGTTCTTGGATCTCGTGCAAGG + Intergenic
1180145466 21:45916246-45916268 GGGGCCCTGGAACTCATGCTGGG - Intronic
1180557979 22:16592727-16592749 GGCTCTTTGGAGCTCATCCTTGG - Exonic
1181529278 22:23507324-23507346 GGGTCCTTGGACCACGCACTGGG - Intergenic
953379196 3:42454241-42454263 TGCTCCTTGAACCTCATCCTTGG + Intergenic
954380109 3:50214818-50214840 GGGTCCTGGGAGGTCATGATTGG - Intronic
955567313 3:60261232-60261254 GGGTTCTTGGACCTCATGCAAGG - Intronic
957333159 3:78792144-78792166 GAGTCCTGGGACCTCATTGTGGG + Intronic
962982545 3:140503827-140503849 GGGTCCTAGGTCCTCATGTGAGG - Intronic
967722600 3:192831148-192831170 GGTTCCTTGGATCACATGCTTGG + Intronic
968410202 4:383893-383915 GGGTCCTTGGGCGGCTTGCTGGG + Intronic
969027565 4:4185984-4186006 GAGTCCATGGACCACAAGCTAGG - Intergenic
969104023 4:4791488-4791510 GGGGCCTTGGCCTTCATGCCTGG - Intergenic
969124908 4:4940049-4940071 AAGACCTTGGGCCTCATGCTTGG - Intergenic
969848138 4:9935789-9935811 GGGTCCCAGGACCTCACGCTGGG + Intronic
972288782 4:37671822-37671844 GGGTTCTTGGACCTCGTGCAAGG - Intronic
976301362 4:83518564-83518586 GGGTCCCTGGAACTCATGAGGGG - Intronic
977397046 4:96484201-96484223 GGGTCCTTGGACCACATTTCTGG - Intergenic
984767438 4:183410270-183410292 GGCTTCCTGGACCTCCTGCTTGG + Intergenic
989676952 5:43983486-43983508 GAGTTCTTGGCCCTCATACTGGG - Intergenic
996549331 5:124713079-124713101 TGTGCCTTGGACGTCATGCTGGG - Intronic
997388678 5:133495975-133495997 GGGTCTTTGGGGCTCCTGCTGGG + Intronic
998044171 5:138972885-138972907 GGGTCCTGGGTCCTCAGGCAAGG + Intronic
998409658 5:141899874-141899896 GAGTCCCTGGCCCTCCTGCTTGG - Intergenic
999109267 5:149103821-149103843 AGTTCCTAGGACCTCCTGCTTGG + Intergenic
1000097669 5:157985906-157985928 GGCTCCCTGAAACTCATGCTTGG + Intergenic
1000976447 5:167770048-167770070 AGGTCCTTGGAGCACATGTTGGG - Intronic
1001994296 5:176143039-176143061 GGGTTCTTGGATCTCATGCAAGG + Intergenic
1003925244 6:10871485-10871507 GGATCCTTGTACCACATGTTGGG + Intronic
1005515577 6:26550926-26550948 GGCTCCATGGGCTTCATGCTGGG - Intergenic
1008194377 6:48500048-48500070 GGCTTCTTGGACCTCAGTCTAGG + Intergenic
1011118585 6:83924694-83924716 GGGTCCTTGTATCTACTGCTAGG + Intronic
1014288374 6:119529293-119529315 TGGTCAGTTGACCTCATGCTGGG + Intergenic
1017041585 6:150312747-150312769 GGGCCCTTGAACCCCTTGCTCGG + Intergenic
1019769068 7:2871907-2871929 AGGTTCTTGAACCTCATCCTGGG - Intergenic
1022466181 7:30654550-30654572 GGGGCTTTGGGCCTCATGATTGG + Intronic
1023165661 7:37341145-37341167 GGAGCTTTGGACCACATGCTTGG - Intronic
1025250697 7:57349505-57349527 AGGTCCTTGCACTTCCTGCTGGG - Intergenic
1026467574 7:70667861-70667883 CGGTCTTTGGACCTAATTCTCGG + Intronic
1034619336 7:152445278-152445300 GGCTCTTTGGAGCTCATCCTTGG + Intergenic
1034788638 7:153947830-153947852 GGGTCCTAGGACCTCCTTCTGGG + Intronic
1035344546 7:158189521-158189543 GGGCCCTTGGACGTCAGTCTAGG + Intronic
1038688833 8:29742862-29742884 GTGTCTTTGGTACTCATGCTGGG + Intergenic
1039657464 8:39425143-39425165 AGGTCCTTGGACCACAGACTTGG - Intergenic
1040933199 8:52756545-52756567 GGCCCCTTGGACGGCATGCTTGG - Intergenic
1041648303 8:60276267-60276289 AGCTCCTTGGACCTCAAGCCTGG - Intronic
1047682881 8:127272936-127272958 GGGCCCTTGAGCCTCTTGCTTGG + Intergenic
1047898889 8:129397867-129397889 GAGTCCTTGGGCATCATACTTGG - Intergenic
1049478428 8:142807536-142807558 GACTCCTTGGCCTTCATGCTGGG - Intergenic
1049726721 8:144149968-144149990 GGTTCCTTGGACCTGACGCGTGG + Intronic
1056825520 9:89873988-89874010 AGGTCCTTGGGGCCCATGCTTGG - Intergenic
1057168723 9:92947991-92948013 GGGTCCTGGGACCCCCGGCTCGG + Intronic
1058553417 9:106139994-106140016 GGGGCCTGGAACCTCATGCTGGG - Intergenic
1061534260 9:131237910-131237932 GGGTCCTTGGCACTCAGGCTGGG + Intergenic
1061766336 9:132883862-132883884 AGGTCCTGGGACCCAATGCTCGG - Intronic
1062207397 9:135344779-135344801 GGGTCCTGGGACTTCAGGCCTGG - Intronic
1187996161 X:24929177-24929199 GGATCCTTGGATCTAATACTTGG + Intronic
1188159084 X:26778289-26778311 GGGTCCTTGGAAGTAAAGCTTGG + Intergenic
1189743121 X:44142137-44142159 GGGTTCTTGGACTTCATGCAAGG + Intergenic
1190408720 X:50113597-50113619 TGGTCCTTGGACCACACTCTGGG + Intergenic
1190920218 X:54843935-54843957 AGGTCCTTGGACCTGAGGTTTGG - Intergenic
1191191764 X:57675439-57675461 GGGTCCTTGAGCCACTTGCTCGG - Intergenic
1191858512 X:65646980-65647002 AGGGCCTTGTACCTCATACTAGG - Intronic
1198641242 X:138758466-138758488 AGTTCCTAGGTCCTCATGCTTGG + Intronic
1199117103 X:144006290-144006312 GGGTTCTTGGATCTCATACAAGG + Intergenic