ID: 1148845509

View in Genome Browser
Species Human (GRCh38)
Location 17:50527635-50527657
Sequence CTGCTCACTGAGAAGGAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 355}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148845509_1148845516 4 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845516 17:50527662-50527684 ATGGAAAAAGGAGAAGCCAGAGG 0: 1
1: 0
2: 3
3: 76
4: 717
1148845509_1148845523 22 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845523 17:50527680-50527702 AGAGGGCAGGAAGAAGACGGGGG 0: 1
1: 0
2: 6
3: 90
4: 793
1148845509_1148845524 23 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845524 17:50527681-50527703 GAGGGCAGGAAGAAGACGGGGGG 0: 1
1: 1
2: 4
3: 100
4: 999
1148845509_1148845517 5 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845517 17:50527663-50527685 TGGAAAAAGGAGAAGCCAGAGGG 0: 1
1: 0
2: 3
3: 79
4: 664
1148845509_1148845518 9 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845518 17:50527667-50527689 AAAAGGAGAAGCCAGAGGGCAGG 0: 1
1: 0
2: 9
3: 64
4: 752
1148845509_1148845519 19 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845519 17:50527677-50527699 GCCAGAGGGCAGGAAGAAGACGG 0: 1
1: 0
2: 12
3: 98
4: 859
1148845509_1148845522 21 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845522 17:50527679-50527701 CAGAGGGCAGGAAGAAGACGGGG 0: 1
1: 0
2: 7
3: 55
4: 622
1148845509_1148845515 -8 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845515 17:50527650-50527672 GTGAGCAGGGGAATGGAAAAAGG 0: 1
1: 0
2: 5
3: 52
4: 574
1148845509_1148845521 20 Left 1148845509 17:50527635-50527657 CCTTGTTCCTTCTCAGTGAGCAG 0: 1
1: 0
2: 2
3: 33
4: 355
Right 1148845521 17:50527678-50527700 CCAGAGGGCAGGAAGAAGACGGG 0: 1
1: 0
2: 6
3: 60
4: 653

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148845509 Original CRISPR CTGCTCACTGAGAAGGAACA AGG (reversed) Intronic
900861545 1:5236378-5236400 AAGCTCACTCAGAAGGCACAAGG + Intergenic
901229027 1:7631717-7631739 ATGCTCCCTGAGAAGGGCCAGGG - Intronic
903778950 1:25809691-25809713 CGGCTCACTGAGCTGGAACTCGG - Exonic
905976024 1:42174253-42174275 ATGCTCACGCAGAAGGTACATGG + Intergenic
906152280 1:43594503-43594525 CTGCTCTGTGAGAATGGACAGGG + Intronic
906838854 1:49113796-49113818 CAGCTCACTGACAATGCACATGG - Intronic
907012917 1:50979734-50979756 CTGTCCACTGAGAAGGAACAGGG - Intergenic
907641894 1:56199014-56199036 CAGCCTACTGAGATGGAACAAGG - Intergenic
909796597 1:79747134-79747156 CTGCTCATTGACAATGTACACGG - Intergenic
910246365 1:85142909-85142931 CAGCTCACGGAGAGGGAGCATGG + Intergenic
910463889 1:87476063-87476085 TTTGTCACTGAGAAGGAACCAGG - Intergenic
911051071 1:93671964-93671986 GTGCTGAGTGAGAAGGCACATGG - Intronic
911316216 1:96359571-96359593 CTGCTCTCTCAGAAGATACAAGG + Intergenic
916998764 1:170331777-170331799 CAGGTAACTGAGCAGGAACAAGG - Intergenic
917044359 1:170841486-170841508 CTTCTCAATTAGAAGTAACATGG + Intergenic
917856040 1:179100838-179100860 CTGCTCCCTCAGAGTGAACAGGG + Exonic
918470575 1:184868793-184868815 CTGCTGACTGAGAAGACACATGG + Intronic
918508199 1:185280881-185280903 CACCACACTGAGAAGCAACAGGG - Intronic
919545948 1:198918821-198918843 CTGCTCATTGAGAATGTACTTGG + Intergenic
920038821 1:203083065-203083087 CTGCTCAGTGGGAAGGGGCAGGG + Intergenic
922157995 1:223054829-223054851 CTGTCCACTGAGAACGAGCATGG - Intergenic
922221767 1:223613726-223613748 CTGCTGACTGAGAAGCAGCCAGG - Intronic
923430422 1:233914469-233914491 CTGCTCACTTAGCAGGAAGAAGG - Intronic
924453572 1:244200090-244200112 CCAGTCACTGAGAAGTAACATGG + Intergenic
1062995694 10:1864522-1864544 CTGCTCATTGACAAGGCACCTGG + Intergenic
1063498914 10:6535973-6535995 CTGCTCAGTAGGAAGGAAGAGGG - Intronic
1064370680 10:14749705-14749727 CTGCTCCCTGGGATGGAAGAGGG - Intronic
1064701251 10:18023875-18023897 CTGCTCAGTGAGGAGTAGCAGGG + Intronic
1065600413 10:27362213-27362235 CTGATCATAGAGAAGGATCATGG + Intergenic
1066171506 10:32852848-32852870 TAGCTCACTGGGAAAGAACATGG - Intronic
1066401732 10:35083399-35083421 CTGTTCACTGAGAAGGGCCTAGG + Intronic
1068220339 10:54036611-54036633 CTGCTCATTGAGAATGCACCTGG + Intronic
1070497575 10:77038396-77038418 CTTCTCACTGGGAAGAAACAGGG - Intronic
1071503948 10:86221914-86221936 CTCCTCACCCGGAAGGAACAGGG + Intronic
1071513565 10:86282472-86282494 CTGTTCCCTGAGATGGACCACGG - Intronic
1072745635 10:97937315-97937337 GCCCTCACTGAGAAGGAACAGGG - Intronic
1072972023 10:100025627-100025649 CTGCACACTGAAAAAGAACTTGG - Intergenic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1075090227 10:119440169-119440191 CTGCCCACCCAGAAGGAAGAGGG + Intronic
1075431701 10:122389334-122389356 CTGCTCACTGACAATGCACGTGG - Intronic
1075676459 10:124299247-124299269 CAGCTCAGTGATAAAGAACAAGG + Intergenic
1076303112 10:129442671-129442693 CTCCTCTCTGAGCTGGAACAAGG + Intergenic
1076694447 10:132240406-132240428 CTTCTCGCTGAGACGGCACAGGG + Intronic
1077755421 11:5023854-5023876 CTGCTCACTCAATAGCAACATGG + Intergenic
1077811911 11:5646732-5646754 CTGTTCCCTGAGAAGGGAGAGGG + Intergenic
1078274486 11:9830074-9830096 CTCCTCATTTAGAAGGACCAGGG - Intronic
1078364098 11:10692639-10692661 CTGCTCACTGGGGTGGCACAGGG - Intronic
1078980699 11:16529738-16529760 CTGATACCTGAGAATGAACAAGG - Intronic
1079195064 11:18318447-18318469 CTACTAAGTGAGAAGGTACAGGG + Intronic
1080874350 11:36262698-36262720 CTTCTCATTGAGAGGGACCATGG + Intergenic
1082861017 11:57856799-57856821 CTGCCCTCTGAGAGGGAAAAAGG + Intergenic
1083284130 11:61646890-61646912 CTGCTCAGTGACAGGGAACCTGG + Intergenic
1083997832 11:66280811-66280833 CGGCTCAGAGAGAAAGAACATGG - Intronic
1084285518 11:68128378-68128400 CTGCCCGCTGAGAAGGAATCCGG + Intergenic
1084288787 11:68148466-68148488 CTGGTCACTCAAAAGGCACAGGG - Intergenic
1084295231 11:68209041-68209063 TTCCTCACTGAGAAGTAAAAGGG - Intronic
1084469863 11:69353306-69353328 CTGGTCACAGAGCAAGAACAAGG + Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1087424687 11:97971572-97971594 CTGTTCACAGAGAAGGCATAAGG + Intergenic
1088647373 11:111927524-111927546 CTGCACACTAAGAATGTACAAGG - Intronic
1089199415 11:116714839-116714861 CAGCTCCCTGAGAAGGATAAGGG + Intergenic
1090114030 11:123947244-123947266 CTGCAAACTGAGAGGTAACAAGG - Intergenic
1090196868 11:124824039-124824061 CTGCTCACTAAGAGGCAAAATGG + Intergenic
1090888610 11:130901962-130901984 CTGAATACTGAGTAGGAACAAGG + Intronic
1090929384 11:131281765-131281787 CTGCTCATTCAAAATGAACAGGG - Intergenic
1091046031 11:132326467-132326489 CTGGTCACTGAGCAGGGGCAAGG + Intronic
1091451806 12:576659-576681 ATGCTCCCTGAGAAAGAGCACGG - Intronic
1091580164 12:1781719-1781741 GTGCCCACTGAGAATGAACAAGG + Intronic
1091977707 12:4838767-4838789 CTTCTCACTGAGGATGCACATGG + Intronic
1092143353 12:6198998-6199020 CTGGTCCCTGAGCAGAAACAAGG + Intergenic
1092678459 12:10949003-10949025 CAGAACACTGAGAGGGAACATGG - Intronic
1093477781 12:19574128-19574150 CTGCCCAGTGAGGAGGAGCAAGG + Intronic
1094573382 12:31661880-31661902 CTTCTCAAGGAGAATGAACAAGG - Exonic
1095466822 12:42496224-42496246 CTGCTCATTGACAAGGTACCTGG - Intronic
1096886106 12:54720920-54720942 ATGCTCACTGAGAAGCAAAATGG - Intergenic
1097904608 12:64906759-64906781 CTACTGACTGAAAATGAACAGGG - Intergenic
1098099312 12:66996897-66996919 CTGCTCACTTAAAAGGAAGAAGG + Intergenic
1099480853 12:83164508-83164530 CTGCTCACTGATAATGTACCTGG - Intergenic
1099789575 12:87315186-87315208 CTGCTCATTGACAAGGCACCTGG + Intergenic
1100791062 12:98130563-98130585 CTGCTCACTGACAATATACATGG - Intergenic
1103485447 12:121279746-121279768 CTGCCCTGTGAGAGGGAACAGGG - Intronic
1104728183 12:131090513-131090535 CTGCCCACTTAGGAGGAAGAGGG - Intronic
1107543874 13:41418620-41418642 TCCCTCACTGAGAAGGGACATGG - Intergenic
1107590124 13:41895134-41895156 CTGTTTACTGAGTGGGAACATGG + Intronic
1107859501 13:44647508-44647530 CAGCAAACTGAGAAGGAAGAGGG + Intergenic
1108527593 13:51299339-51299361 CAGCTCACTGAGGTGGCACATGG - Intergenic
1108703442 13:52963506-52963528 CTGCCCTCTGAGGATGAACATGG + Intergenic
1110060505 13:71033289-71033311 CTGCCCAGTGAGAAGTAGCAGGG - Intergenic
1110282505 13:73711643-73711665 CTGCTCACTGACAATGCACCTGG + Intronic
1110411583 13:75209488-75209510 CTGCTCACTGACAATGCACCTGG - Intergenic
1110746374 13:79058172-79058194 CTGCTCACTGACAAGGCACCTGG + Intergenic
1110786290 13:79531161-79531183 CTGCTCACTGACAATGCACCTGG - Intronic
1111062969 13:83047133-83047155 CTATTCACTGAGGAGCAACATGG + Intergenic
1111939968 13:94598189-94598211 CTCCTCACTTTGAAAGAACATGG - Intergenic
1112664148 13:101550348-101550370 CTGCCCACTGTGAAAGAGCAGGG + Intronic
1113320587 13:109228685-109228707 CTGTTCCCTGAAAAGCAACATGG - Intergenic
1113504909 13:110809208-110809230 CTGCTCCCTGGGAAGGAAATAGG + Intergenic
1115138276 14:30137942-30137964 CTGCTCAGTGAGATGAATCAAGG + Intronic
1116607111 14:47014129-47014151 CTGCTCACTGACAATGCACCTGG - Intronic
1118330591 14:64812623-64812645 CTGCTCACCGAGAAGGGAGGAGG - Intronic
1118666543 14:68076001-68076023 CTGCCCACTGAGGAGTAACATGG + Intronic
1118716183 14:68561609-68561631 CTGGTCCCTGAGAAGCCACACGG - Intronic
1120035993 14:79698996-79699018 CTGCTCAAGGAAAAGGAAAAAGG - Intronic
1121830325 14:97045912-97045934 CTGCTCAGTGAGAAGGAAACGGG - Intergenic
1122258442 14:100498160-100498182 CTGCCCACTGACAGGGTACATGG - Intronic
1122729622 14:103786421-103786443 CAGTTCACAGAGAAGGAAAATGG - Intronic
1122834171 14:104423071-104423093 CAGCTCCCTGAGGGGGAACAAGG + Intergenic
1122929167 14:104925622-104925644 CTGGTCAATGAGAGGAAACATGG - Intronic
1122996595 14:105268603-105268625 ATCCTCTCTCAGAAGGAACAAGG - Intronic
1125082337 15:35689634-35689656 CTCCACACTAAGAAAGAACAAGG - Intergenic
1126919332 15:53503373-53503395 CTCTTCACAGAGATGGAACATGG - Intergenic
1127148555 15:56050398-56050420 CAGCCAACTGAGATGGAACACGG - Intergenic
1127595207 15:60474690-60474712 ATGCTCACTGGGAAGAAATAAGG - Intronic
1129169535 15:73799196-73799218 CTGCTCAGAGAGGAGGAGCAAGG + Intergenic
1129906572 15:79191814-79191836 CATCTCACTGAAAAGGACCAGGG - Intergenic
1130619973 15:85452762-85452784 CAGGACACTGAGAGGGAACATGG - Intronic
1132309770 15:100849027-100849049 CTTCTGCCTGAGAAGGAAAAAGG - Intergenic
1136056503 16:27693750-27693772 CTGCTCCCTGAGAAGGGTCAAGG - Intronic
1138246814 16:55473463-55473485 CTGCTTATTGAGAAGGCACCTGG - Intronic
1143001130 17:3795676-3795698 CGGCTCACTGAGCTGGAGCAGGG + Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1147764933 17:42828117-42828139 TGGCTCCCTTAGAAGGAACATGG + Intronic
1148845509 17:50527635-50527657 CTGCTCACTGAGAAGGAACAAGG - Intronic
1150074241 17:62179170-62179192 CTGCTCATGGAAAAGGATCAGGG - Intergenic
1151826080 17:76525172-76525194 CAGCTCCCTGAGAAGGGACCAGG - Intergenic
1152003820 17:77664444-77664466 CTTCTCACTGAGAATTCACAAGG + Intergenic
1153658041 18:7302747-7302769 CTGTTCACAGAGATGGAACTCGG + Intergenic
1153785460 18:8529803-8529825 CAGAGCACTGAGAAGGAACACGG + Intergenic
1153877884 18:9391876-9391898 CTGCTCACTGACAATGTACCTGG - Intronic
1155894248 18:31303719-31303741 ATGCTCCCTGAGAAGTAAAAAGG - Intergenic
1156496840 18:37531259-37531281 CTCCTCACTGAGCAGGAAACTGG + Intronic
1156604729 18:38652896-38652918 CTGCTCTAAGAGAAGGCACACGG + Intergenic
1156609832 18:38713045-38713067 CTGCTCAGGGAGATGGAATAAGG - Intergenic
1157045748 18:44100099-44100121 CTGCCCAGTGAGAAGTAGCAGGG + Intergenic
1157201163 18:45661100-45661122 CTGCTAACTGTGAAGAATCAGGG + Intronic
1158417088 18:57258014-57258036 CTGCTCACTAAACAGGAACATGG - Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161012108 19:1965050-1965072 CTGCTCACTGACAACGCACCTGG + Intronic
1161101849 19:2425387-2425409 CTGCTCGCTGAGGAGGCGCACGG - Exonic
1161499703 19:4607136-4607158 CGGCTCCCGGAGAGGGAACAAGG - Intergenic
1161544611 19:4872731-4872753 CTTCTCAGTGAGAAAGAACTAGG - Intergenic
1164983530 19:32631625-32631647 CTGCTCACTGAGACGGAGGACGG + Intronic
1165125159 19:33589802-33589824 CTGCTCATTGACAATGAACCTGG + Intergenic
1165268859 19:34687401-34687423 CAGGTCTCTGAGAAGGAAGAAGG + Intergenic
1167498892 19:49834764-49834786 CTGCCCACTGAGAGGGAAAGCGG - Intronic
925115198 2:1372650-1372672 GTGCTCACCGTGAAGGAAGATGG + Intergenic
925337165 2:3107076-3107098 CTGCTCGCTGAGAAGAATCTGGG + Intergenic
925337209 2:3107274-3107296 CTGCTCACTGAGAAGAACGTGGG + Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
925820401 2:7794201-7794223 CTGCTCACAGAGCAGGAGAAAGG - Intergenic
925906873 2:8544974-8544996 CTGCTCCCTGTGAGGGACCAAGG - Intergenic
926774703 2:16410387-16410409 CTGCCCCTTGAGAAGGTACAAGG - Intergenic
928789809 2:34936383-34936405 CTGCCCACTGTGAAGGATGATGG + Intergenic
929891852 2:45924913-45924935 CTGCTCACTGATGAGCACCAAGG - Intronic
930494174 2:52117978-52118000 CTGTGCACTGAGAAGGGAAAGGG - Intergenic
931499798 2:62853808-62853830 CTGCTCACTGACAATGCACCAGG - Intronic
931836695 2:66106773-66106795 CTGCTGACTGGGAAGCAACTTGG + Intergenic
933633535 2:84682533-84682555 GTGCACACTGAGAAGGAAGCTGG - Intronic
933707196 2:85300573-85300595 TGGCACACTGAAAAGGAACAAGG + Intronic
934477854 2:94604795-94604817 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
934810617 2:97273477-97273499 CAGATCATTGAGAGGGAACATGG + Intergenic
934827075 2:97434462-97434484 CAGATCATTGAGAGGGAACATGG - Intergenic
934840634 2:97622040-97622062 CTGCTCAATGAGGATGACCAGGG + Intergenic
935870338 2:107441265-107441287 CAGCTCACTGGTAACGAACATGG - Intergenic
936708583 2:115104539-115104561 TTACTCAGTGTGAAGGAACAAGG - Intronic
936942862 2:117903586-117903608 CTCCCCACTGAGCAGGAACTTGG + Intergenic
937131956 2:119520530-119520552 CTGCTCACTGTGCAGCCACAGGG + Intronic
937886295 2:126901857-126901879 CTTCTCCCTCAGCAGGAACAGGG + Exonic
938621391 2:133058153-133058175 CTGCTCACTGACAATGTACTAGG + Intronic
940608494 2:155959718-155959740 CTGCTCACTGACAATGCACTTGG + Intergenic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
943360367 2:186911757-186911779 CTGCTGGCTGAGGAGGGACAAGG - Intergenic
944858090 2:203787009-203787031 CTCATCACTGACAAGGAATAGGG - Intergenic
944907402 2:204276241-204276263 CTGCTCATGGTTAAGGAACAAGG - Intergenic
945487174 2:210410088-210410110 CTGCTCACTGACAATGTACTTGG - Intergenic
946561159 2:220915465-220915487 CTGCTTGCTGAGAAGATACAGGG - Intergenic
946789461 2:223285461-223285483 CTGCTAACTCAGAAGGGGCAGGG + Intergenic
947012254 2:225579412-225579434 CTGCTAATTGAGAAGGAATCTGG - Intronic
948771893 2:240255444-240255466 CTGGTCACTGAGAGGGCAGAAGG - Intergenic
1170429292 20:16261789-16261811 CTGCTCACAGAGGAGGAAAAAGG + Intergenic
1170682671 20:18540338-18540360 CTGCTCACTGACAATGCACCTGG - Intronic
1171493877 20:25540624-25540646 CTGCTCGCCCAGAAAGAACAGGG + Intronic
1172609683 20:36240619-36240641 GTGCTTGGTGAGAAGGAACAAGG + Exonic
1173668311 20:44778697-44778719 CTGTTGACTGAAAAGGAGCAGGG - Intronic
1174682249 20:52420025-52420047 CTGGACACTGAGGAAGAACAAGG - Intergenic
1175074995 20:56364658-56364680 CGGCTCACTGAGTAGGAAAGGGG + Intronic
1177925087 21:27204058-27204080 CTGATCACTGGGAAGGCAGAAGG + Intergenic
1178537931 21:33425564-33425586 CTGCTCACTTAGCTGGGACAAGG + Intronic
1181515880 22:23412456-23412478 CTGCTCACTGACAATGCACCTGG + Intergenic
1182053264 22:27329335-27329357 CTGCTGCCTAAGAAGGAAGATGG - Intergenic
1182299767 22:29330960-29330982 CTGCTCACCGAGGAGGAGGAAGG - Intronic
1182345360 22:29660005-29660027 CTGCAAACTGAGAAGGTACTGGG - Intronic
1183204323 22:36408139-36408161 CTGGGCACTGAGTAGGCACATGG + Intergenic
1184886162 22:47345575-47345597 CTGCTCCCTCAGAAGCACCAGGG + Intergenic
1185017520 22:48353369-48353391 CTGCTCCCTGAGAAGGGGCTGGG - Intergenic
1185050365 22:48551108-48551130 CTGCTCACTGAGACACCACAGGG - Intronic
1185277042 22:49954291-49954313 CTGCTCACGGAGAAAGAGCAAGG - Intergenic
949354548 3:3164692-3164714 CTGCTCATTGACAATGTACATGG + Intronic
949542979 3:5048626-5048648 ATGCACACTGAGAAGCAAAATGG + Intergenic
950246257 3:11421907-11421929 CTGCTCACTGACAATGCACCTGG - Intronic
950505616 3:13392723-13392745 CTGCACACTGAGCTGAAACAGGG + Intronic
951176258 3:19604244-19604266 CTGTTCACTGACAATGAACATGG - Intergenic
951197132 3:19836642-19836664 CAGAGCACTGAGAAGGAACATGG + Intergenic
951450825 3:22836529-22836551 ATGCACACTGAGAGGGAAAATGG - Intergenic
951506843 3:23456587-23456609 CTGCTCACTGACAATGCACCTGG - Intronic
952119355 3:30223388-30223410 CTGCTCATTGACAAGGGACCTGG - Intergenic
953027981 3:39155723-39155745 CTGCTCACAGACAAAGCACAAGG - Intergenic
953606164 3:44414736-44414758 CTTCTGACTGAGAAGGGACTGGG - Intergenic
955604213 3:60682625-60682647 CTGCTCACTGAAAATGTACCTGG + Intronic
955969879 3:64428026-64428048 CTGCTCACTGACAATGCACCTGG + Intronic
956089826 3:65654206-65654228 CTGCAAACTGAGAAGAATCAGGG - Intronic
957469049 3:80634686-80634708 CTGCTCACTGACAATGCACCTGG - Intergenic
960296011 3:115944858-115944880 ATGCACAGTGAGAGGGAACATGG - Intronic
960758762 3:121049384-121049406 TTGCTCAGTGAGAAGTAGCAGGG + Intronic
960844679 3:121994752-121994774 CTGCTCAGAGTGAAGGAAAAAGG + Intronic
961269614 3:125679451-125679473 CTGCTCACTGAGAAGCCAAAAGG - Intergenic
961583621 3:127903727-127903749 CTGCTCATTCAGAAGGGAAAGGG - Intergenic
962364434 3:134768508-134768530 ATGCTGACTGAGAAGGTAGAAGG - Intronic
962928758 3:140018558-140018580 TGGCTCTCTGAGGAGGAACATGG + Intronic
963047617 3:141114491-141114513 TTCCTCACTGTGAAGTAACATGG + Intronic
964948702 3:162260635-162260657 CTGCTCATTGAGAATGCACCTGG + Intergenic
965295610 3:166942555-166942577 CTGCTCAGTGAAGAGTAACAGGG - Intergenic
966312346 3:178607881-178607903 TTGCTAGCTGAGTAGGAACATGG - Intronic
966361803 3:179137672-179137694 CTGCCCAGTGAAAAGTAACAGGG - Intergenic
967725118 3:192854930-192854952 CTGCTCACTGACAATGCACTTGG + Intronic
968550018 4:1217301-1217323 CTGTTCTACGAGAAGGAACATGG + Intronic
968940072 4:3633198-3633220 CTGCCCACTGAGAAGGTCCTCGG - Intergenic
969288653 4:6224309-6224331 CTGCTAACTGGGAAGCAACAAGG - Intergenic
969401646 4:6959571-6959593 CTGCTGAGTGAGTGGGAACAAGG + Intronic
971003771 4:22351578-22351600 CTGCCCAGTGAAGAGGAACAGGG - Intronic
971479902 4:27105163-27105185 CTGATCACATAAAAGGAACATGG + Intergenic
971819277 4:31530617-31530639 CTGCCCAGTGAGAAGTAGCAGGG + Intergenic
972958264 4:44419335-44419357 TTACTCACTGAGAAGGGCCAGGG + Intronic
974095359 4:57357837-57357859 CTGCTTTCTGAGAAGGAAATGGG - Intergenic
975159479 4:71109448-71109470 CTGATCACAGAGATGCAACAGGG - Intergenic
975391765 4:73826722-73826744 CTGCTCACTGATCAGGAAGTTGG + Intergenic
975682014 4:76886467-76886489 CTGCCCAGTGAGAAGGTACTTGG + Intergenic
977005868 4:91569233-91569255 CAGAGCAATGAGAAGGAACATGG - Intronic
977346461 4:95822689-95822711 CTGCTCTCTGAGAGAGAATATGG + Intergenic
977612817 4:99053796-99053818 CTGCTCACTGACAATGCACCTGG - Intronic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
978687831 4:111469221-111469243 CTGCTCAGTGAGAATGAATCTGG + Intergenic
979576903 4:122303349-122303371 CTGCTCACTGACAATGCACCTGG + Intronic
979843054 4:125470102-125470124 CTGCTCACTGACAATGCACCTGG - Intronic
982065434 4:151650382-151650404 CTTCTCACTAAGGAGGAAGAAGG + Exonic
982148112 4:152420693-152420715 CTGCTCACTGACAATGCACCTGG - Intronic
982344564 4:154343061-154343083 CTGCTCACTGACAATGCACATGG - Intronic
983093579 4:163536468-163536490 CTGCACACGGAGAAATAACATGG - Intronic
983248826 4:165321313-165321335 CTGCTCAATGTGAAGAGACAAGG + Intronic
983794761 4:171848182-171848204 CTGCTCACTGACAATGCACCTGG - Intronic
986157395 5:5190210-5190232 CTGCTTATTAACAAGGAACAAGG - Intronic
986472979 5:8094238-8094260 GAGCTCCCTGAGAAGGAAGATGG - Intergenic
986679322 5:10219269-10219291 CAGCTCATTCTGAAGGAACAAGG + Intergenic
987095858 5:14548926-14548948 CTGCTCATTGACAAGGCACCTGG - Intergenic
987121944 5:14776075-14776097 CTGCTCCCTGGGAAGAAACGTGG - Intronic
987329023 5:16838982-16839004 CTGCTCACTGACAATGCACCTGG + Intronic
987644113 5:20647652-20647674 CTCCTCACTGGGCAGGACCAGGG + Intergenic
987716015 5:21572116-21572138 CTGCTCATTGACAAGGCACCTGG + Intergenic
988456080 5:31388416-31388438 CTGAACACTGAGAAGCCACAGGG - Intergenic
989592082 5:43121354-43121376 TTGCTCTCTGAGAAGAAACCGGG - Intronic
990755279 5:59062040-59062062 CTGCTTACTGTTAAGGAGCAAGG + Intronic
991429541 5:66529921-66529943 CTGCTTACTGACAAGGAGCAGGG + Intergenic
991641294 5:68756770-68756792 ATGCTGAATGAGAAGGAAAAGGG - Intergenic
992127858 5:73660732-73660754 CTGCTCACTGACAATGTACCTGG - Intronic
992592950 5:78314624-78314646 CTGCTCAATGACAAGGCACCTGG - Intergenic
993030836 5:82704084-82704106 CTGCTGACTGAGGAGGATAAAGG - Intergenic
994414213 5:99447686-99447708 CTAATCACTGAGCAGGAACAAGG + Intergenic
994547701 5:101187588-101187610 CTTTTATCTGAGAAGGAACATGG + Intergenic
994827555 5:104734581-104734603 CTGCTGACTGAGCAGGAAGGTGG + Intergenic
995653735 5:114401455-114401477 CTGTTAACTGAGAAATAACAAGG + Intronic
996783810 5:127216503-127216525 AAGCTGACTGAGAGGGAACATGG + Intergenic
997291418 5:132738399-132738421 CAGCACACTGAAAAGGGACAAGG - Intergenic
997781606 5:136665021-136665043 CTTTTCACTGAGAAGGAAACTGG - Intergenic
997781696 5:136666204-136666226 CTGGTCACTGGGAAGGAAGATGG - Intergenic
1000152747 5:158519294-158519316 CTGTTCCAGGAGAAGGAACAGGG + Intergenic
1000422185 5:161050942-161050964 CTAGTGACTGGGAAGGAACATGG + Intergenic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1001091475 5:168744779-168744801 CTGCTCACTGACAATGTACCTGG + Intronic
1001781845 5:174375619-174375641 CTCTTCACTGAATAGGAACAAGG + Intergenic
1002087197 5:176783496-176783518 CTCCTCAGTGGGAAGGAACTGGG + Intergenic
1003003134 6:2355903-2355925 CTGCTGAGTGAGAAAGAAGAGGG + Intergenic
1003419064 6:5939432-5939454 CTGGTGACTGAGAAGGACCCGGG + Intergenic
1004461014 6:15836062-15836084 GTGTTCACAGAGAAGGAAAAGGG - Intergenic
1005835949 6:29709771-29709793 CTTTTCAATGAGAATGAACAGGG + Intergenic
1005862153 6:29909951-29909973 CTGCACACTGGGATGGAAGATGG + Intergenic
1006284712 6:33083773-33083795 CTGCTTTCTGAGGAGGAAAAAGG + Intronic
1006734885 6:36266541-36266563 CTGGACAATGAGAAGTAACAGGG - Intronic
1007178937 6:39914692-39914714 CTGCTCAGTGAGAGGGTAAAGGG + Intronic
1007686308 6:43669289-43669311 CTTCTCCCTGAGCAGGACCAGGG + Intronic
1009000706 6:57709944-57709966 CTGCTCATTGACAAGGCACCTGG - Intergenic
1010288910 6:74113010-74113032 CTGCTCATTGAAAATGAACCTGG + Intergenic
1010714066 6:79207844-79207866 CTTCCCACTGAGAAGGTAGAGGG - Intronic
1011605594 6:89101981-89102003 CAGCTCACCGAGAAGTACCAGGG - Intronic
1012640828 6:101610996-101611018 CTGCACACTGAGAAGAAAATTGG - Intronic
1013374716 6:109503480-109503502 CTGATCAGTGAGATGGTACAAGG - Intronic
1014614881 6:123587041-123587063 CTGCTCAGGGTGAAGGAAAAGGG + Intronic
1015197355 6:130537755-130537777 CAGAGAACTGAGAAGGAACATGG + Intergenic
1016636918 6:146303221-146303243 CTTCTCACAGAGAAGGGACTGGG - Intronic
1016676453 6:146775437-146775459 CTGCTTACTGAGATGGTTCATGG + Intronic
1016866438 6:148772347-148772369 CTGCTCAGTAAGAGGGAAGAAGG - Intronic
1017513738 6:155137474-155137496 CTGCTCTTTGAGAAGGAACAGGG + Exonic
1018250498 6:161865142-161865164 CTACTCACTGAGAATGTACCTGG - Intronic
1018424046 6:163664057-163664079 CTGCTCAGGTAGAAGGAAGAGGG - Intergenic
1018847949 6:167568070-167568092 CTGGCCACTGAGAGAGAACATGG - Intergenic
1019863660 7:3684386-3684408 CCCCTCACTGAGAAGCAGCAAGG + Intronic
1020465705 7:8476283-8476305 CAGCTGACAGAGAAAGAACAGGG - Intronic
1022517456 7:30984942-30984964 CTGCTCACTGGGGAGGGCCATGG - Intronic
1023085508 7:36566704-36566726 ATGCACACTGAGAGGCAACATGG + Intronic
1023747455 7:43334539-43334561 TTGCTTAGAGAGAAGGAACAAGG - Intronic
1024287792 7:47774350-47774372 CTGCACACTGGGAAAGGACAGGG - Intronic
1024669331 7:51577746-51577768 CTCCCCTCTGAGAAAGAACAGGG + Intergenic
1024886873 7:54152425-54152447 TTAATCACTGAGAAGGCACAGGG + Intergenic
1026035134 7:66825169-66825191 CTGCTCTCTGGGCAGGGACAAGG - Intergenic
1026036917 7:66836610-66836632 CTGCTCTCTGGGCAGGGACAAGG - Intergenic
1026092562 7:67313329-67313351 CTGCTCAGTGATAAGGCACCTGG - Intergenic
1026240130 7:68566512-68566534 GTGCTCACTGAAAAGTATCACGG + Intergenic
1026318171 7:69245606-69245628 CTCATCCCTGAGAAGGAGCAGGG + Intergenic
1027640243 7:80724102-80724124 CTCCAGAATGAGAAGGAACATGG + Intergenic
1029000561 7:97150512-97150534 CTGCTCACTGACAATGCACCTGG - Intronic
1029187135 7:98747256-98747278 TTGCACAATGAGAAGGAACAAGG - Intergenic
1029299802 7:99571665-99571687 CTGCTCATAGAGAAGGAAATGGG - Intronic
1030483750 7:110139385-110139407 CTGCTCATTGAGAATGCACCTGG + Intergenic
1030567613 7:111179167-111179189 CTGCTCATTGAAAATGCACATGG - Intronic
1030841297 7:114357648-114357670 CTGCTCACTGAGAGTGATGAAGG - Intronic
1033583020 7:142753604-142753626 CTGCTCACAGAGATGGAACTAGG - Intronic
1033584569 7:142764526-142764548 CTGCTCACAGAGATGGAACTAGG - Intergenic
1033586047 7:142775081-142775103 CTGCTCACAGAGATGGAACTAGG - Intergenic
1034519998 7:151612508-151612530 CTGCTCACTGTGAAGCAACCTGG + Intronic
1034830247 7:154302709-154302731 CTCTTTACTGAGAAGGAAAATGG + Intronic
1035116849 7:156532082-156532104 CTGCTCACTGGGAAGGATATGGG - Intergenic
1036371910 8:8169508-8169530 CTGCTAAGGGTGAAGGAACAAGG - Intergenic
1036878994 8:12496135-12496157 CTGCTAAGGGTGAAGGAACAAGG + Intergenic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1038257594 8:25964657-25964679 CTCCTCTCTGGGAATGAACAGGG - Intronic
1038484854 8:27927253-27927275 CTGCTCCCTGAGCAGGAAACTGG + Intronic
1038786012 8:30617138-30617160 CTGCTCAATGTGAGGGAACTTGG - Intronic
1039921184 8:41895787-41895809 GTGCTCCCTGAGAAGGGTCAAGG + Intronic
1041026230 8:53689509-53689531 CTGCTCACTGATACAGATCAGGG + Intergenic
1042587175 8:70353627-70353649 CTGCTGACAGATAAGTAACAAGG - Intronic
1042795525 8:72658915-72658937 CTGCTCACTGACAATGCACTTGG + Intronic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1043448096 8:80339272-80339294 CTACTCACTCAGAAGGGAAATGG + Intergenic
1043548789 8:81344998-81345020 CTGCAGCCTGAGAAAGAACAGGG + Intergenic
1043601439 8:81943116-81943138 CTGCTCACTGACAATGTACCTGG + Intergenic
1043687857 8:83110482-83110504 CTGCTCATTGACAATGCACATGG - Intergenic
1043799772 8:84593564-84593586 CTACTCTGTGAGAAGGCACATGG - Intronic
1044640089 8:94370464-94370486 CTGCTGACTGATCAGGAACCTGG - Intergenic
1045073095 8:98531364-98531386 CTGCTCAGTGAGAATGCACCTGG - Intronic
1045696852 8:104818817-104818839 CTGCTCCCTGATAATGAAAAAGG + Intronic
1046487778 8:114909343-114909365 CTGCCCAGTGAGGAGTAACAGGG - Intergenic
1047880281 8:129185501-129185523 CTGTTTACTGATAAGGAACCTGG - Intergenic
1049254708 8:141607655-141607677 CTGCCCAGTGAGAAGGAGGAAGG - Intergenic
1049468649 8:142765236-142765258 CTGGCCGCTGAGAAGGAGCATGG - Intronic
1051084855 9:13336799-13336821 CTGCTCACTGACAATGCACCTGG - Intergenic
1051105568 9:13575724-13575746 CTGCCTTCTGAAAAGGAACATGG + Intergenic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1052111275 9:24585779-24585801 CTGCTCATTGACAAGGCACCTGG - Intergenic
1052276714 9:26685012-26685034 TTGCTCACTGTGAAGGGAGAGGG + Intergenic
1052852101 9:33384761-33384783 CTGCGCCCTCAGTAGGAACAGGG - Intronic
1052901789 9:33799742-33799764 CTGCTCACAGAGATGGAACTAGG - Intergenic
1053482470 9:38425784-38425806 CTGCAAACTGGGAAGGAACTGGG - Intergenic
1053680205 9:40481312-40481334 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1053930196 9:43109622-43109644 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054283507 9:63143623-63143645 CTGCGCCCTCAGTAGGAACAAGG + Intergenic
1054293285 9:63316822-63316844 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054391313 9:64621315-64621337 CTGCGCCCTCAGTAGGAACAAGG - Intergenic
1054504416 9:65895012-65895034 CTGCGCCCTCAGTAGGAACAAGG + Exonic
1054722932 9:68621793-68621815 CAACACACTGAGTAGGAACATGG + Intergenic
1055322967 9:75100203-75100225 CTGCTCACAGAGACAGAAGAAGG - Intronic
1055398966 9:75902553-75902575 CTGCTCAATGATAAGGTCCAGGG + Intronic
1057910937 9:99020291-99020313 CAGCTCACTGACCAGGACCAGGG + Intronic
1058332444 9:103780105-103780127 CAGCTTACTGATAAGTAACATGG - Intergenic
1058461589 9:105188992-105189014 CAGAACACTGAGAGGGAACATGG - Intergenic
1059716536 9:116918277-116918299 CTGCTCATTGAGCAGGAAACAGG + Intronic
1059764112 9:117367076-117367098 GTGCTCACTGAAAAAGAAGATGG - Intronic
1060414619 9:123421578-123421600 ATTCTCACTGAGTAGGGACACGG - Intronic
1060844020 9:126820525-126820547 CTGCTCATTGAGAAGGCACTTGG + Intronic
1062084421 9:134641542-134641564 CGGCTCTCAGAGAAAGAACAGGG + Intergenic
1062572043 9:137190235-137190257 CTGCTGGCTGAGGAGGGACAAGG - Exonic
1185805234 X:3050872-3050894 ATGCACACTGAGAAGCAAAACGG - Intronic
1187473718 X:19591081-19591103 CTGCTCACTGTGAAAGAAAGAGG + Intronic
1190141763 X:47853040-47853062 CTGCTCACTGACAATGCACCTGG - Intronic
1190327937 X:49218275-49218297 ATGGTCACTTGGAAGGAACATGG + Intronic
1190463079 X:50698343-50698365 CTGGTGACTGAGAAGGGGCATGG - Intronic
1193285534 X:79710198-79710220 CTGCTCATTGAGAATGCACCTGG - Intergenic
1194736482 X:97518154-97518176 CTGCTCACTGCCATGGAACATGG + Intronic
1195241839 X:102960123-102960145 CTGCCCACTGAGGAGTAACAGGG + Intergenic
1197345754 X:125324832-125324854 CTGCTGACTGAAAAGGGACTTGG - Intergenic
1197654118 X:129097820-129097842 TTGATCAGTGAGAAAGAACAAGG + Intergenic
1199363693 X:146952415-146952437 CCGTTCACTTAGAAGCAACAGGG + Intergenic
1201276034 Y:12299732-12299754 ATGCACACTGAGAAGCAAAACGG + Intergenic