ID: 1148851078

View in Genome Browser
Species Human (GRCh38)
Location 17:50555667-50555689
Sequence TGCCCCACCCCAAGGGGGTT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148851078_1148851085 12 Left 1148851078 17:50555667-50555689 CCCAACCCCCTTGGGGTGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1148851085 17:50555702-50555724 TCCCAACTGACTAGAGACTCAGG 0: 1
1: 1
2: 1
3: 9
4: 92
1148851078_1148851089 22 Left 1148851078 17:50555667-50555689 CCCAACCCCCTTGGGGTGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1148851089 17:50555712-50555734 CTAGAGACTCAGGCCCTGCAGGG 0: 1
1: 0
2: 3
3: 20
4: 196
1148851078_1148851088 21 Left 1148851078 17:50555667-50555689 CCCAACCCCCTTGGGGTGGGGCA 0: 1
1: 0
2: 2
3: 15
4: 140
Right 1148851088 17:50555711-50555733 ACTAGAGACTCAGGCCCTGCAGG 0: 1
1: 0
2: 9
3: 17
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148851078 Original CRISPR TGCCCCACCCCAAGGGGGTT GGG (reversed) Exonic
900237291 1:1598878-1598900 CGCCCCACCCCACTGGGCTTAGG - Exonic
900718804 1:4161737-4161759 TGCCCCGCCCCCATGAGGTTTGG - Intergenic
900914038 1:5621844-5621866 TGCCCCACACCCAGCGGGTTCGG - Intergenic
902365185 1:15968537-15968559 TCCCCCAACCCAAGTGAGTTTGG - Intronic
903185643 1:21627330-21627352 TGCCACACCCCAAGAGGGGAAGG + Intronic
904492592 1:30870169-30870191 TTGCCAACCCCAGGGGGGTTTGG + Intronic
905297067 1:36960972-36960994 TGACCCACCCCAAAGCTGTTTGG - Intronic
908393427 1:63703800-63703822 CCCCCCACCCCCAAGGGGTTGGG + Intergenic
912469039 1:109894064-109894086 TGGCCTACCCCAGGGGGCTTTGG + Intergenic
916459169 1:165004809-165004831 TGGCCCTCCCCAATGGGGGTGGG - Intergenic
919802509 1:201362086-201362108 TGCTCCACCCCCAGGGGGTTTGG - Intronic
920417763 1:205810259-205810281 GGGCCAACGCCAAGGGGGTTCGG - Exonic
924599125 1:245472778-245472800 TGACCCAGCCCAAGGGGCTCAGG - Intronic
924779210 1:247131416-247131438 TGCCCCTCCCCCTGGGAGTTGGG - Intronic
1066064938 10:31755219-31755241 TGCCCCACCCCATGGGCTTCTGG + Intergenic
1066305182 10:34133311-34133333 TCCCCCTCCCCTAAGGGGTTTGG + Intronic
1067038530 10:42935950-42935972 TGCCCCACCCTGAGGGGCTCGGG + Intergenic
1067723071 10:48744175-48744197 CCTCCCACCCCAAGTGGGTTGGG - Intronic
1067760326 10:49040057-49040079 TGCCTCACCCCAAGGGGATGAGG + Intronic
1070788226 10:79174661-79174683 TGCCCCACACCAACTGGGCTTGG - Intronic
1073058174 10:100715293-100715315 TTCCCCACCCCAAGTGGCTTAGG + Intergenic
1075172422 10:120128001-120128023 TGCCCCTCCCCCGGGGAGTTTGG + Intergenic
1075742957 10:124706833-124706855 GGCCCCACCCCAAGGGTGAGTGG - Exonic
1081825925 11:46051691-46051713 TGCCTCAACTCAAGGGGGTGAGG + Intronic
1083782353 11:64925036-64925058 TCCCCCACCCCATGAGGTTTGGG + Intronic
1083895835 11:65619322-65619344 TGCCCCACCCCACTGGTGGTGGG - Intronic
1084967658 11:72752758-72752780 GGCCACACCCCCAGGGGGATAGG + Intronic
1089194732 11:116687573-116687595 TTCCCTACACCAAGGGGGATGGG + Intergenic
1090599466 11:128355418-128355440 TCCCCCACCTCAAGGGGATGCGG + Intergenic
1092217797 12:6694960-6694982 TGCCCCACCCTCAGTGGGATGGG + Exonic
1093604421 12:21073261-21073283 AGCCCCACCCCTAGGGGAATGGG - Intronic
1095190952 12:39257434-39257456 GGCCCCAACCCAAAGGGGTCTGG + Intergenic
1096599561 12:52719849-52719871 TGCGCCACAGCAAGTGGGTTTGG - Intergenic
1097262646 12:57728171-57728193 TGCCCCACTCCCAGGGGCTCGGG - Intronic
1098482966 12:70987064-70987086 TGCCCCACTCTAAGGGAGGTTGG - Intergenic
1100231270 12:92610523-92610545 TGCCCCACCCAAAGGCTGTTTGG - Intergenic
1101921168 12:108934329-108934351 TGGCCCTTCCCAAGGGGGTAGGG - Intronic
1102623534 12:114216387-114216409 AGCCCCATCCCAAGAGAGTTGGG + Intergenic
1102745431 12:115244977-115244999 TTCACCAGCCCAAGGGGCTTGGG - Intergenic
1103925906 12:124423247-124423269 TGCTCCACCCCAGGGGTGCTGGG + Intronic
1104766903 12:131335995-131336017 TGCCCCAAGCCCAGTGGGTTGGG + Intergenic
1104945906 12:132414823-132414845 TGCCCCACCCCAGGGAGCTGTGG + Intergenic
1105404672 13:20123513-20123535 TCCTCCACCCCAAGTGTGTTCGG - Intergenic
1105946855 13:25197732-25197754 TGCCCCTCCCTAATGGGGTTGGG + Intergenic
1107439785 13:40415537-40415559 TGCCCTCTCCCATGGGGGTTGGG - Intergenic
1108114384 13:47111074-47111096 TAGTCCAACCCAAGGGGGTTGGG - Intergenic
1110406293 13:75154095-75154117 TGCACCACCCCAAATGGGTAAGG + Intergenic
1110808792 13:79789549-79789571 AGCTCCACCCCAGGGAGGTTTGG - Intergenic
1114269839 14:21093935-21093957 TTCCCCACCGCCAGGGGGTGGGG - Intronic
1115303768 14:31913737-31913759 TGCCCCACCCTCAGGGACTTCGG - Intergenic
1120998835 14:90436903-90436925 TGCCCCAGCCCCATGGGATTCGG - Intergenic
1121239269 14:92416324-92416346 TGCTCTACCCCAAGGGGACTCGG + Intronic
1121453194 14:94022430-94022452 TATGCCACCCCAATGGGGTTGGG - Intergenic
1121928431 14:97949654-97949676 TGCCACATCCCAAGGGGTTCAGG + Intronic
1123758810 15:23417046-23417068 GGCCCCACCCCCAGGCGGCTGGG - Intergenic
1125919444 15:43516995-43517017 TGCCCCACCCCAACAGGCTAGGG + Intronic
1128235863 15:66066669-66066691 TGCCACACCCCTAGGGGGGCTGG + Intronic
1128613433 15:69091406-69091428 TGCCCCAGCCCAGGGGGGATTGG - Intergenic
1129336357 15:74854350-74854372 GGCCCCTCCCCAAGGAGGTCAGG - Intronic
1130369530 15:83272968-83272990 GGCCCCCCCCCAAGGGCATTTGG - Intronic
1132028423 15:98421512-98421534 TCTGCCACCCCAAGGGGCTTGGG + Intergenic
1134457526 16:14405814-14405836 GGCCCCACCCCCAGGCGGCTCGG + Intergenic
1139174366 16:64669625-64669647 TGGGCCACCGCAAGGGAGTTGGG + Intergenic
1142291436 16:89195237-89195259 TGCCCCAGGCCCAGGGGGGTCGG - Exonic
1146437007 17:32859502-32859524 TGCCCCAACCCAATGGCTTTAGG + Intronic
1148851078 17:50555667-50555689 TGCCCCACCCCAAGGGGGTTGGG - Exonic
1151701424 17:75744536-75744558 TGCCCCAGTCCAGGGGGCTTTGG + Intronic
1151769822 17:76153291-76153313 CACCCCAGCCCAAGGGGGTTTGG - Intronic
1152464512 17:80458253-80458275 TGCCCCACCTGAAGTGGGTCTGG + Intergenic
1152697726 17:81804999-81805021 TGCCCCGCCCCCACGGGGTGAGG + Intronic
1153815046 18:8784320-8784342 TGCCCCAGCCCAAGCGGGAAGGG + Exonic
1153820266 18:8825990-8826012 GACCCCACCCCAATGGGGCTAGG - Exonic
1153837701 18:8978814-8978836 TGCCCAACCCCATGGGCGGTGGG + Intergenic
1156198375 18:34802159-34802181 TGCCCCACTCCCAGGCTGTTTGG + Intronic
1158435222 18:57430613-57430635 GACCCCACCCCAAAGGGCTTTGG - Intergenic
1158979837 18:62749282-62749304 TCCCCCACTCCCAGGAGGTTTGG - Intronic
1159216865 18:65403611-65403633 TGCTCCATGCCAAGGGAGTTAGG + Intergenic
1160415917 18:78710803-78710825 TGCCCTGCCCCCAGGCGGTTAGG + Intergenic
1163719848 19:18893883-18893905 TGCGTCAGCCCAAGGGAGTTGGG + Intronic
1163782216 19:19256591-19256613 TGCTCCACCCCCAGGCGGTTTGG - Exonic
1165312886 19:35039566-35039588 TCCCCCATCCCCCGGGGGTTGGG + Intronic
927366145 2:22299012-22299034 GACCCCAGCCCAAGGGAGTTGGG + Intergenic
934857141 2:97736608-97736630 TGCCGCAGCTCCAGGGGGTTGGG + Intronic
937931023 2:127205330-127205352 AGTCCCACCCCATGGGGATTTGG + Intronic
947748816 2:232522601-232522623 TGCCCCACCCCAAGGTGAGAAGG + Exonic
948360726 2:237418289-237418311 TGGGCCACCCCAAGGGAGATGGG - Intergenic
1169052818 20:2595037-2595059 TGCCCCACCAGAAGGGAGGTAGG - Intronic
1171460386 20:25294635-25294657 TACCCCACCCCAGGGAGTTTTGG - Intronic
1174975647 20:55330060-55330082 TGCCACACCCCCAATGGGTTGGG + Intergenic
1175570837 20:60020378-60020400 TGCCCTACCCCAAGTGGGAGAGG - Intronic
1178704754 21:34864149-34864171 GGCCCCACCCCATGGCGGCTGGG + Intronic
1179088097 21:38238200-38238222 TGCCCCAGCCCAAGAGGGTTGGG + Intronic
1179969973 21:44830594-44830616 TGCCACACCCAAAAGGGGTGGGG + Intergenic
1180877337 22:19180689-19180711 TGCTCCCTCCCCAGGGGGTTGGG + Intronic
1182692245 22:32172152-32172174 TGGCCCACACTGAGGGGGTTGGG + Intergenic
1183102344 22:35591744-35591766 TGTCCATCCCCAAGGCGGTTTGG - Intergenic
1183212238 22:36458156-36458178 GGCCCCACCCCCAGGGGCTGTGG - Intergenic
1184925204 22:47631667-47631689 GGCCCCTCCCCAAGGTGGGTGGG - Intergenic
1185020088 22:48369393-48369415 TGCCCCACCCCAGATGTGTTGGG + Intergenic
1185320568 22:50198612-50198634 TGCCACCCCCCATGGGGGTCTGG + Exonic
950190680 3:10974243-10974265 AGTCCCATCCCAAGGGGGATGGG - Intergenic
950533481 3:13566544-13566566 TGAGCCACCCCAAGGGGCCTGGG + Intronic
950812794 3:15665680-15665702 TGCCCCATCCCACGGAGGTAGGG + Intergenic
952349717 3:32522450-32522472 TGTCCCACCTAAAGGGGGTGGGG + Intergenic
952818401 3:37465388-37465410 TGCCACACCAGGAGGGGGTTTGG + Intronic
952984794 3:38769772-38769794 AGCCCCATCCCCAGGGGATTGGG - Intronic
953928281 3:46993359-46993381 TGCCCCACCCTGAGGGGGTCAGG - Intronic
954089069 3:48270556-48270578 AGCCCCAGCCCAAGGGAGTAAGG - Exonic
954654622 3:52186359-52186381 TGCCCCCTCCCAAGGGGGCCTGG + Intergenic
958585185 3:96077963-96077985 TCCCCCACCTCAAGGAGTTTGGG - Intergenic
961734466 3:128992921-128992943 TGCCCCACCCCAAAGCGGGCTGG - Intronic
964174206 3:153805868-153805890 TGGCACTACCCAAGGGGGTTAGG - Intergenic
967136967 3:186520778-186520800 TGCCCCACACCAGTGGGGTGAGG + Intergenic
968935269 4:3607002-3607024 TGCCCCACCCCACTGTGGCTTGG - Intergenic
970666556 4:18343224-18343246 TGTCCCTCCCCATGGGAGTTTGG + Intergenic
976229202 4:82823019-82823041 AGCCCTACCCCAAGGGGGCAAGG + Intronic
977337804 4:95720192-95720214 TGGCCCTCCCCAATGGGGGTGGG - Intergenic
980130653 4:128812606-128812628 TTTCCCACCCCAAGCGGGTGGGG + Intronic
982226606 4:153172940-153172962 GGCCACAACCCCAGGGGGTTGGG + Intronic
983476027 4:168212775-168212797 GGACCCACCTCAAGGTGGTTAGG + Intergenic
984626163 4:182009735-182009757 TGCCCCTCCCCCTGGGAGTTCGG + Intergenic
985979666 5:3451993-3452015 TGCCCCACTCCAAGGAGCTCAGG + Intergenic
999997903 5:157109854-157109876 TCCCCTACCCCAAGAGGCTTTGG + Intronic
1000335468 5:160238551-160238573 TGCCCCACCCCAAGGTAGCCAGG - Intronic
1001925286 5:175631528-175631550 TGCCCTACCCCAAGGTGGGTGGG - Intergenic
1002761533 6:206112-206134 TTCCCCACCCCAAGCAGGTGGGG + Intergenic
1002786340 6:403197-403219 TGCCCAACCCCAAGAAGGATGGG - Intronic
1007585232 6:42985043-42985065 TGCCCAAACCGAAGGGGGATCGG - Intronic
1016385877 6:143530400-143530422 TTCTCCACCCCAAGCGGGTTAGG + Intergenic
1016993818 6:149947190-149947212 TGCCCCACACCAGGGGGGAGAGG + Intronic
1017004515 6:150020347-150020369 TGCCCCACACCAGGGGGGAGGGG - Intronic
1022111689 7:27236008-27236030 TCCCCCTTCCCAAGTGGGTTGGG - Intergenic
1022563395 7:31373106-31373128 TGCCCCAACACAAGGCAGTTTGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1029521642 7:101066565-101066587 TGCCCCACCCCCAGGGTGTCTGG - Intergenic
1029540464 7:101179616-101179638 TGGCCCAGCCAAAGGGGGTGGGG + Intronic
1031976461 7:128096867-128096889 GGCCCCACCCCACGGGGATTGGG - Intergenic
1035398976 7:158552306-158552328 AGCCCCACCCCAATGGGGTGTGG - Intronic
1036618131 8:10404409-10404431 TGCCCCTCCCCACGGAGGGTTGG - Intronic
1036910866 8:12755668-12755690 TCCCCCACCCGGAGGGGGCTCGG - Intronic
1037918781 8:22789507-22789529 AGCCCCACCTCAGGGGGCTTAGG - Intronic
1045391636 8:101721003-101721025 TGCCCAACCCAAAGGGGGCATGG + Intronic
1049743046 8:144250130-144250152 TACGCCAGCCCAAGGGGGTGGGG - Intronic
1054454915 9:65424900-65424922 TGCCCCACCCCACTGTGGCTTGG + Intergenic
1055490793 9:76803731-76803753 TGCACCAACCCAAGTGGGTCAGG - Intronic
1055505076 9:76939783-76939805 TACCCCACCCCATGTGGGTGGGG + Intergenic
1057847099 9:98534074-98534096 TGCCCCACCAAAAGGGCCTTGGG - Intronic
1058793875 9:108478335-108478357 TGCCCTAACCCAAGGGGACTAGG + Intergenic
1062048820 9:134436899-134436921 TGCCACACCCCACGGGGCTTGGG + Exonic
1062332212 9:136049784-136049806 TGCCCTACCCCCAGGGGGAGCGG - Exonic
1062581400 9:137230699-137230721 AGCCCCACTCCAGGAGGGTTGGG + Intergenic
1062724525 9:138064219-138064241 TGCCCCTCCCCAAGGAGATCTGG - Intronic
1187445727 X:19359155-19359177 GCCCCCACCCCAAGGGACTTTGG - Intronic
1190641238 X:52483665-52483687 AGACCCTCCCCAAGGGGGATGGG + Intergenic
1190646434 X:52529200-52529222 AGACCCTCCCCAAGGGGGATGGG - Intergenic
1192691794 X:73372821-73372843 TTCCCTACCCAAAGGTGGTTAGG + Intergenic
1194945122 X:100057782-100057804 TGCCCAACATCAAGGGGGCTGGG - Intergenic
1199586941 X:149424340-149424362 AGCCCCACCCCAAGGGGAAAGGG + Intergenic