ID: 1148852375

View in Genome Browser
Species Human (GRCh38)
Location 17:50561322-50561344
Sequence GCGCAAGCTGAGCCCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148852375_1148852393 27 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852393 17:50561372-50561394 CGGGGCCCCCGGGTTGCGTGAGG 0: 1
1: 0
2: 0
3: 17
4: 137
1148852375_1148852381 7 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852381 17:50561352-50561374 CCCACCAGATGTGCCCCCGCCGG 0: 1
1: 0
2: 0
3: 4
4: 93
1148852375_1148852384 9 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852384 17:50561354-50561376 CACCAGATGTGCCCCCGCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 87
1148852375_1148852383 8 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852383 17:50561353-50561375 CCACCAGATGTGCCCCCGCCGGG 0: 1
1: 0
2: 1
3: 13
4: 126
1148852375_1148852387 17 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852387 17:50561362-50561384 GTGCCCCCGCCGGGGCCCCCGGG 0: 1
1: 0
2: 7
3: 40
4: 342
1148852375_1148852386 16 Left 1148852375 17:50561322-50561344 CCTCCCGGGGGCTCAGCTTGCGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1148852386 17:50561361-50561383 TGTGCCCCCGCCGGGGCCCCCGG 0: 1
1: 0
2: 6
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148852375 Original CRISPR GCGCAAGCTGAGCCCCCGGG AGG (reversed) Intronic