ID: 1148853780

View in Genome Browser
Species Human (GRCh38)
Location 17:50567563-50567585
Sequence GACTCTGTAGGGCCCAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148853780_1148853787 -1 Left 1148853780 17:50567563-50567585 CCTGCTCTGGGCCCTACAGAGTC 0: 1
1: 0
2: 0
3: 22
4: 231
Right 1148853787 17:50567585-50567607 CTGGCTTGGTGGGTCATGCCAGG 0: 1
1: 0
2: 8
3: 162
4: 809

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148853780 Original CRISPR GACTCTGTAGGGCCCAGAGC AGG (reversed) Intronic
900316559 1:2060084-2060106 GAGACTGTTGGGCCCTGAGCAGG + Intronic
901512924 1:9726825-9726847 GACTCTGAAGTCCCCAGAGAGGG + Intronic
902926131 1:19696916-19696938 GGCTCTGTATGGTCCAGAGCCGG - Intronic
903563844 1:24249476-24249498 TGCTCTGTAGGGCACAGTGCTGG - Intergenic
903646597 1:24899901-24899923 GAGTCTGTAAGGCCCAAAGTGGG - Exonic
903928518 1:26848905-26848927 GACTCAGGAGGGCCCAGGGGAGG + Intronic
904301585 1:29557795-29557817 CACTCCTTAGGGCCCAGAGAGGG + Intergenic
904345960 1:29869907-29869929 AAATCTGAAGGGCCCAAAGCAGG - Intergenic
904713494 1:32449178-32449200 GACTCTGTAGGGTCCAGCCTGGG - Intergenic
904971841 1:34425419-34425441 CAAACTGCAGGGCCCAGAGCAGG + Intergenic
905462414 1:38130310-38130332 GCCCCTGGAGGGCCCAGAACAGG + Intergenic
905463867 1:38138583-38138605 GTCTTTGGAGGGCCAAGAGCAGG + Intergenic
905629561 1:39511108-39511130 GGCTCTGGAGGGGGCAGAGCTGG - Intronic
905668198 1:39775082-39775104 GGCTCTGGAGGGGGCAGAGCTGG + Intronic
906077907 1:43065498-43065520 GACTGTGCAGGGCCCCGATCAGG + Intergenic
910312356 1:85838626-85838648 GTCTCTGTAGGGTCCAGTGGGGG - Exonic
911319594 1:96396453-96396475 GACTCTCTAGGGCTGGGAGCAGG - Intergenic
914195884 1:145447970-145447992 CCCTCTGTGGGGCCCTGAGCTGG + Intergenic
914410364 1:147421646-147421668 AGCTCTGTAGGGCCCAGATGTGG - Intergenic
915286929 1:154859058-154859080 GCCTTTGGAGGGCTCAGAGCTGG - Intronic
916782824 1:168054291-168054313 GACTCTGCAGAGTCCCGAGCTGG + Intronic
916943902 1:169704718-169704740 GCCTTTGGAGGCCCCAGAGCTGG - Exonic
919514835 1:198510500-198510522 AACTCTGACTGGCCCAGAGCAGG + Intergenic
923521890 1:234741303-234741325 GCTTCTGTAGGGTCCCGAGCAGG + Intergenic
924577241 1:245291806-245291828 GACAGTGTGGGGCCCAGAGACGG + Intronic
924692863 1:246368433-246368455 GATTCTGTGGGTCCCAGGGCTGG - Intronic
1067142001 10:43666161-43666183 GACTCTGCAGAGCCCAGAGGTGG + Intergenic
1067438071 10:46292715-46292737 GGCTCTCTATGGCTCAGAGCAGG - Intronic
1067792174 10:49296657-49296679 GGGTCTGCATGGCCCAGAGCTGG - Intergenic
1068630088 10:59289396-59289418 GGCTCTGCAGGGCACAGACCTGG - Intronic
1069181770 10:65369955-65369977 GCCTCTCTATGGCACAGAGCAGG + Intergenic
1069476363 10:68736484-68736506 GAGGCTGTGGGGCCCAGGGCAGG - Intronic
1070798085 10:79228763-79228785 GGCTATGTAGAGCCCAGTGCTGG + Intronic
1072019120 10:91381293-91381315 GACACTGTTGGGATCAGAGCAGG - Intergenic
1073151198 10:101312814-101312836 GGCTCTCTAGGTCCCAGAGCTGG - Intergenic
1074059878 10:109955275-109955297 TAGTCTGTTGGGCCCAGTGCAGG + Intergenic
1075836589 10:125458796-125458818 CTCTCTGGAGGGCCCACAGCTGG + Intergenic
1075956237 10:126525479-126525501 GAATGTCTAGAGCCCAGAGCCGG + Intronic
1076170819 10:128318490-128318512 GACTCTGTGTGGCCCAAAGGAGG - Intergenic
1076886021 10:133262783-133262805 GGCTCAGCAGGCCCCAGAGCAGG + Exonic
1076904626 10:133355875-133355897 GACTCCCCAGGGCCCAAAGCAGG + Intronic
1077050469 11:564158-564180 TGCTCAGTAGGGCCCAGGGCTGG + Intergenic
1077295122 11:1822937-1822959 AACTCTGGAGGGCTCAGGGCAGG - Intergenic
1079086726 11:17451310-17451332 GACTCATGGGGGCCCAGAGCTGG - Intronic
1079090338 11:17476353-17476375 GCTTCTGCAGGGCCAAGAGCTGG - Intronic
1079875827 11:25856098-25856120 GACTCTGCAGAGTCCAGAGATGG - Intergenic
1081392648 11:42547091-42547113 GCTTCTGCATGGCCCAGAGCTGG - Intergenic
1081655548 11:44854679-44854701 GACACTGTGGGGACCAAAGCAGG + Intronic
1083932172 11:65852072-65852094 GTCTCTGAAGGGCCTTGAGCAGG - Intronic
1084033110 11:66492556-66492578 GACCCAGTAGGGCCCAGGCCTGG + Intronic
1085467318 11:76733048-76733070 GCCTCTGCAGGGCCTAGTGCAGG + Intergenic
1085733227 11:79017176-79017198 GAATGTGTGAGGCCCAGAGCTGG - Intronic
1087882593 11:103435584-103435606 AATTCTGTAGGGACCAAAGCTGG + Intronic
1089682006 11:120123870-120123892 GACTCTGTGGGGCACAGGGCTGG - Intronic
1095702536 12:45205162-45205184 GACTATGTAGGGGACAGAGGTGG + Intergenic
1095825521 12:46526444-46526466 TACTCTGGAGGGGACAGAGCAGG - Intergenic
1096092783 12:48914478-48914500 GCCTCTGCAGGGCCAAGAGCTGG - Exonic
1097156547 12:57016237-57016259 GCACCTGTAGGGCCGAGAGCTGG - Intronic
1101892590 12:108730815-108730837 AGATCTGCAGGGCCCAGAGCTGG + Intronic
1103716745 12:122949562-122949584 GCCTCTGTGGGGCCCAGGCCAGG - Intronic
1104648951 12:130517277-130517299 GACTCTGTAGGGTCCCAAGGTGG - Intronic
1105638099 13:22235729-22235751 GACTCTGTGGGGCTGAGAGTGGG + Intergenic
1105782625 13:23717278-23717300 GACACTGTTTGGCCCAGAGTGGG - Intergenic
1108500584 13:51066451-51066473 GACACTGTAGGGCCAAGTGTTGG - Intergenic
1110375152 13:74785074-74785096 AAATCTGTAAGGCTCAGAGCAGG - Intergenic
1110928246 13:81182977-81182999 GATTCTGTAGGGGCCAGAGTAGG + Intergenic
1112386536 13:98945477-98945499 GACACTAGAGGGCCCAGAGGAGG - Intronic
1112594888 13:100798757-100798779 GACTCTGTAAGCCCCAGGGAAGG + Intergenic
1113154420 13:107302196-107302218 GACTCTGCAGAGCCCACACCAGG + Intronic
1114319280 14:21533577-21533599 GACTCTGTAGGGGAGAGAGAAGG + Intronic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1117398643 14:55337862-55337884 GATTCTGAAGGGCCCATGGCAGG - Intronic
1121727708 14:96165296-96165318 GAGTCTGTAGCGCCCAGCCCTGG - Intergenic
1122794779 14:104200753-104200775 GGGTGTGGAGGGCCCAGAGCAGG - Intergenic
1124156058 15:27226125-27226147 AAGTCAGTAGGGCCCTGAGCTGG + Intronic
1124318480 15:28693208-28693230 GACTTTGTAGGGCTGAGCGCGGG + Intergenic
1125281931 15:38051154-38051176 GACACTTTAGGGCCCAGGGAAGG + Intergenic
1127797601 15:62451929-62451951 GACTCTGGAGACCCCAAAGCAGG - Intronic
1128065635 15:64762925-64762947 GTCGGTCTAGGGCCCAGAGCTGG - Intronic
1128219659 15:65959205-65959227 GACTCTGTTGGGCCCTGAGAAGG - Intronic
1128242048 15:66107830-66107852 GTATCTGTAGGGCCCAGTGCTGG - Intronic
1129334452 15:74843872-74843894 GGCTGTCTCGGGCCCAGAGCCGG + Exonic
1129909426 15:79213738-79213760 CATAATGTAGGGCCCAGAGCAGG + Intergenic
1130093664 15:80840676-80840698 GGCGCTGCAGGGCCCAGGGCCGG - Intronic
1132627151 16:896711-896733 GATTCTGCAGGGAGCAGAGCTGG - Intronic
1132723746 16:1330004-1330026 GACTCTGAAGCCCCCAGAGCTGG + Intergenic
1133924052 16:10180234-10180256 AACACTGTGGGGCCCCGAGCAGG - Exonic
1134533099 16:15000419-15000441 GACACTGTAGAGATCAGAGCAGG - Intronic
1134761530 16:16719003-16719025 GATTCTGTAGGTCCCTGAGGGGG - Intergenic
1134984528 16:18640167-18640189 GATTCTGTAGGTCCCTGAGGGGG + Intergenic
1135143063 16:19938106-19938128 GACACCCAAGGGCCCAGAGCTGG - Intergenic
1136395751 16:29991622-29991644 GACCCTGGAGGGCACTGAGCTGG + Intronic
1137585744 16:49663399-49663421 GATTCTGTAGGGCCTCGAGGGGG - Intronic
1138520343 16:57567479-57567501 AACTCTGCAGGGACCAGGGCTGG - Exonic
1138857405 16:60710939-60710961 GACACAGTAGGACTCAGAGCAGG - Intergenic
1139430323 16:66907673-66907695 GTCTCTGCAGGGCCCTGGGCAGG - Intergenic
1140245640 16:73245664-73245686 GAATTTGTATGGTCCAGAGCTGG + Intergenic
1141297621 16:82784502-82784524 GACAATGTAGGGCACATAGCAGG - Intronic
1142932277 17:3297007-3297029 ATCTCTGCAGGGCCCAGAGGGGG - Intergenic
1143541717 17:7573194-7573216 CACTATGTGTGGCCCAGAGCCGG + Intronic
1143750531 17:9023521-9023543 GACCCGGGAGGGCTCAGAGCAGG + Intronic
1144794555 17:17882293-17882315 GCATATGTAGGGCCCAGATCTGG - Intronic
1145907556 17:28524636-28524658 GAGCCTGAAGGGCCCAGGGCCGG - Exonic
1146479971 17:33197368-33197390 GAAAGTGTGGGGCCCAGAGCAGG - Intronic
1146831184 17:36070694-36070716 GACTCTGCAGGCCCCAGGCCAGG - Intronic
1147758787 17:42784403-42784425 GTCCCTGTAGGGTCCACAGCAGG - Exonic
1148694653 17:49551658-49551680 GACTGTGTAGAACCCAGGGCTGG + Intergenic
1148797271 17:50203081-50203103 AACTCTGTAGGGCTGAGAGAAGG + Intergenic
1148853780 17:50567563-50567585 GACTCTGTAGGGCCCAGAGCAGG - Intronic
1149544896 17:57496255-57496277 GGCTCTGTAGGGCACACGGCTGG - Intronic
1151311198 17:73293406-73293428 GATTGTGGAGGGCCCAGACCAGG + Intronic
1151329092 17:73396350-73396372 TACTCTGAAGGGCACAGAGCTGG + Intronic
1151731700 17:75915136-75915158 GTTCCTGTAGGGCCCAGGGCAGG + Exonic
1152558028 17:81064267-81064289 GGCCCTGTAGTGCCCACAGCCGG + Intronic
1152708010 17:81855339-81855361 GACCCTGTAGAGCCCAGGCCAGG + Intronic
1155381790 18:25230831-25230853 GACTTTTTAGGCCACAGAGCTGG - Intronic
1158382494 18:56948774-56948796 CACTCTGAAGAGCACAGAGCAGG - Intronic
1158423011 18:57312829-57312851 GACTCTGGAGGGCCAAGAAGTGG + Intergenic
1160939422 19:1613437-1613459 CACTCTGTGGGCCCCAGGGCAGG + Intronic
1162041080 19:7971431-7971453 GGCTGTGCAGGGCCCAGGGCCGG - Intronic
1162588679 19:11577038-11577060 CACTCTGTTGGGCACAGACCTGG + Exonic
1162786621 19:13038991-13039013 GACTCTGTGGGGAACAGTGCTGG + Intronic
1162817799 19:13207163-13207185 GACTCTGGAGAGGCCAGGGCTGG - Exonic
1163364418 19:16868215-16868237 CACACTGAAGAGCCCAGAGCAGG + Intronic
1163773703 19:19205769-19205791 GACACTGGAGAGCCCAGATCTGG + Intergenic
1163821608 19:19499430-19499452 GACTGTGAGGGGCCCAGGGCAGG + Intronic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1165097475 19:33417443-33417465 GGGTATGTGGGGCCCAGAGCAGG - Intronic
1165572972 19:36791188-36791210 GACCCTGAAGGGACCTGAGCGGG - Intergenic
1165912126 19:39236086-39236108 GACTCTGCAGGGCCCTAAGGTGG - Intergenic
1166127653 19:40725321-40725343 TGCTCTGTAGGGAGCAGAGCAGG - Exonic
1166647199 19:44540974-44540996 ACCTCTGAGGGGCCCAGAGCTGG + Intergenic
1167904622 19:52648801-52648823 GACTCCGTAGTGACTAGAGCAGG - Intronic
1168276309 19:55280453-55280475 GAGTCTGAAAGGCCTAGAGCAGG - Intergenic
925701950 2:6647759-6647781 GACTTTCTAGTACCCAGAGCTGG + Intergenic
927492112 2:23527447-23527469 GAGACTGTGGAGCCCAGAGCAGG + Intronic
927930316 2:27039659-27039681 GACACTACAGGGCCCAGAGCAGG - Intronic
928201378 2:29249750-29249772 GCCTCCGTGGGGCCCAGGGCGGG - Intronic
928215035 2:29354360-29354382 GAATCTGATGGGCCCAGATCTGG - Intronic
931644182 2:64406508-64406530 GCCTCTGTAGAGCTGAGAGCTGG + Intergenic
932737540 2:74264949-74264971 GACTCTGTTGCTCCCAGGGCAGG - Intronic
934538934 2:95159137-95159159 GGACCTGCAGGGCCCAGAGCAGG + Intronic
934576776 2:95406922-95406944 GGCTCTGTAGAGACCAGAGCAGG - Exonic
934638995 2:96015090-96015112 GGCTCTGTAGAGACCAGAGCAGG - Intergenic
934794653 2:97090322-97090344 GGCTCTGTAGAGACCAGAGCAGG + Exonic
936344241 2:111663033-111663055 GGCTCTCTAGGTGCCAGAGCTGG - Intergenic
938319234 2:130352013-130352035 GCATCTGCATGGCCCAGAGCAGG - Intergenic
938901883 2:135805344-135805366 GACTGAGCAGGGGCCAGAGCAGG - Intronic
942059567 2:172215697-172215719 GACTCTCTGTGGCACAGAGCAGG - Intergenic
943425767 2:187731767-187731789 GAATTTGTAGAGGCCAGAGCAGG + Intergenic
943663339 2:190582686-190582708 GACTCTGTACGAGCAAGAGCAGG + Intergenic
945273257 2:207962770-207962792 GACAGTGCAGTGCCCAGAGCAGG + Intronic
947667254 2:231914159-231914181 GACACTGAGGGGCCCAGTGCTGG - Intergenic
947832511 2:233151563-233151585 GACTCTGCAGGCCCCAGCTCGGG + Intronic
1171736646 20:28793859-28793881 GACTCTGTAGGTTCCACATCTGG - Intergenic
1172113631 20:32561497-32561519 GCCTCTGGGGGGCCCAGAGCAGG + Intronic
1174133091 20:48359694-48359716 GTCTCAGCAGAGCCCAGAGCTGG + Intergenic
1174153311 20:48501149-48501171 AAATCTGTAGGTCCCCGAGCTGG - Intergenic
1175162383 20:57018729-57018751 GACACTGTCGGTCCAAGAGCGGG + Intergenic
1176162564 20:63655261-63655283 GACTCTGGAGGTCCCAGAGAGGG - Intergenic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1179390867 21:40990189-40990211 GACCCAGTAGAGCCCAGAGCTGG - Intergenic
1179390924 21:40990476-40990498 GACCCAGTAGAGCCCAGCGCTGG - Intergenic
1180800921 22:18631489-18631511 GACCCTGTTGGGCCCTGAGGAGG - Intergenic
1182421720 22:30251693-30251715 GGCTCTCCAGGGCCCAGAGATGG - Intergenic
1184211670 22:43039822-43039844 CAGTCTCTGGGGCCCAGAGCAGG - Exonic
1184688981 22:46108927-46108949 GATGCTCTAGGGCCCAGAGGAGG - Intronic
1185100694 22:48839384-48839406 AACTGTGGAGGGCACAGAGCAGG + Intronic
1185238374 22:49727550-49727572 GCCTCTGTAAGCCCCAGCGCAGG + Intergenic
1185331271 22:50253052-50253074 TCCTCTGCATGGCCCAGAGCAGG + Exonic
950686941 3:14625532-14625554 GACTCAGTAGGTCCCGGGGCCGG + Intergenic
952223554 3:31350466-31350488 GAGTCGGGAGGGCCCAGAGAAGG + Intergenic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
954675220 3:52311861-52311883 GGCTTTGGCGGGCCCAGAGCAGG - Intergenic
955043287 3:55336858-55336880 CACTCTGCAGGACCCAGTGCTGG + Intergenic
959102944 3:102034166-102034188 GACACTGAAGGGCCCAGACATGG + Intergenic
959910920 3:111762732-111762754 GAGTCTGTGGGGATCAGAGCTGG - Intronic
960021325 3:112957032-112957054 TACTCTGGTGGGCCCAGAGTTGG + Intronic
960602201 3:119469281-119469303 TACTCTCCAGGGTCCAGAGCAGG - Intronic
961033991 3:123629623-123629645 GACTCTGGAGAGACAAGAGCAGG + Exonic
961815225 3:129546767-129546789 GACTCTCCAGGGCACACAGCCGG - Intronic
962108549 3:132417823-132417845 GACTTTGTGGGGCTCAGGGCAGG + Intronic
962736503 3:138329906-138329928 GACTGCGTTGGGCCCAGAGTGGG - Intergenic
968592440 4:1465781-1465803 GAGTCTGCAGGGAGCAGAGCTGG - Intergenic
969113852 4:4859657-4859679 GCCGCGGTAGGGCCCGGAGCCGG + Exonic
969202703 4:5618409-5618431 GACCCTGTAGGGCCAGCAGCTGG + Intronic
969320922 4:6412053-6412075 GGGTCTGTGGGGCCCAGAGCTGG - Intronic
970148928 4:13068786-13068808 GACTCTGTTGTGCCTAGAGAGGG + Intergenic
970669054 4:18375151-18375173 GACTCTGCAGGGTCCTGAGATGG - Intergenic
971451988 4:26809240-26809262 GCGTCTGCAGGGCACAGAGCAGG - Intergenic
971797963 4:31253317-31253339 GGCTCTGAGGGGCCCAGAGAAGG + Intergenic
972750091 4:41980056-41980078 GAATCTACAGGCCCCAGAGCTGG - Intergenic
972902719 4:43704030-43704052 GCCTCCTTATGGCCCAGAGCAGG + Intergenic
973894290 4:55396363-55396385 GGCTGTGCAGGGCCCCGAGCCGG + Exonic
973942291 4:55923420-55923442 GAGTCTGAAGGCCCCAGAACTGG + Intergenic
975677632 4:76842721-76842743 CACTCAGTAGGGCCCAGAAAAGG - Intergenic
980252135 4:130331084-130331106 GACTCTGCAGGGCTCAGGACAGG + Intergenic
982120509 4:152138757-152138779 GCCTGTGTTGGCCCCAGAGCTGG - Intergenic
984750329 4:183266607-183266629 GACTCTGAAGGGCTCATGGCTGG + Intronic
984758072 4:183342541-183342563 GACTCTGTGGGCCCCAGGCCAGG + Intergenic
989110499 5:37902399-37902421 GACTTTCTGGGGCCCAGAGGAGG - Intergenic
993136084 5:83966199-83966221 GACTATTTAGGGCACTGAGCTGG + Intronic
993226083 5:85168384-85168406 TAGTCTGTGGGGCCCAGAGCAGG - Intergenic
995554115 5:113310071-113310093 GGCTCTGAAGGGCCAAGAGTAGG - Intronic
996102580 5:119459655-119459677 GACTCTGTAGAGTCCCGAGATGG + Intronic
997584448 5:135035934-135035956 GTCTCTCCACGGCCCAGAGCGGG - Intronic
998351703 5:141506108-141506130 GAGTCACTAGGGCCCAGAGCAGG + Intronic
998822257 5:146067527-146067549 GACTCTCTAGGGCCCAGGCCAGG - Intronic
998922495 5:147084882-147084904 AACTCTGAAGGGCCCTGTGCAGG - Intergenic
1002417368 5:179127491-179127513 GACTCTCTGGGGTCCAGAGTGGG + Intronic
1002927952 6:1615443-1615465 GACTCGGCAGGGCCCCCAGCCGG - Intergenic
1003232715 6:4269209-4269231 GACTCTGCAGAGCCCTGAGGTGG - Intergenic
1005442092 6:25881185-25881207 GACTCTGCAGAGTCCAGATCTGG - Intronic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1007244427 6:40450328-40450350 GACTCTGATGGGCCAGGAGCTGG - Intronic
1008514734 6:52308277-52308299 GACTCTGGAGGCCACACAGCTGG - Intergenic
1011557241 6:88583957-88583979 GGCTCTGTAGTGCCCAGAATAGG + Intergenic
1014950773 6:127552313-127552335 CACTATGTTGTGCCCAGAGCTGG + Intronic
1016748378 6:147605930-147605952 GACTCTAGTGGGCCCAGAGCAGG + Intronic
1017616485 6:156251823-156251845 GACTTAGGAGAGCCCAGAGCAGG - Intergenic
1018311174 6:162510535-162510557 GGCCCTGGAGGGCTCAGAGCTGG - Intronic
1019401207 7:855215-855237 GTCTCTCGAGGGCACAGAGCAGG + Intronic
1019738072 7:2660210-2660232 GAGGCTGGCGGGCCCAGAGCCGG - Intronic
1019934583 7:4245982-4246004 AGCTCTGCGGGGCCCAGAGCAGG - Intronic
1022508958 7:30923222-30923244 GCCTCTGTGGGGCCCAGCTCAGG - Intronic
1023320668 7:38994370-38994392 GATTCTGCAGGTCCCAGAGGAGG + Intronic
1026422899 7:70258963-70258985 GACTCTGGAGGGCCCGATGCTGG - Intronic
1031226125 7:119040468-119040490 GACTCTGCAGAGTCCAGAGGTGG - Intergenic
1031970196 7:128059213-128059235 GACTCTTCAGTGCTCAGAGCTGG + Intronic
1033128379 7:138724516-138724538 GCCTCTGTAGGACCCAGAAGTGG + Intronic
1033311416 7:140264678-140264700 GACCCAGTGGAGCCCAGAGCTGG - Intergenic
1037700481 8:21269579-21269601 GAATCTGTAGGGCATAGAGTAGG - Intergenic
1037903406 8:22701529-22701551 GACTCTTTGGGGCCCAGAATTGG + Intergenic
1040861882 8:52007979-52008001 CACTCAGAAAGGCCCAGAGCTGG - Intergenic
1044531683 8:93314755-93314777 GACTCTTTGGGGCCCAGGGATGG - Intergenic
1049229853 8:141476291-141476313 GCCTCTGCAGGGCCTTGAGCTGG + Intergenic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1049474387 8:142790041-142790063 GCCTCTGTGGGACCCACAGCAGG + Intergenic
1049559704 8:143303571-143303593 GAATCTGGAGGACACAGAGCCGG - Intergenic
1049804389 8:144532393-144532415 GACCCTGCAGGGCACAGGGCAGG + Exonic
1050120102 9:2299276-2299298 GACACAGCAGGACCCAGAGCAGG - Intergenic
1057304908 9:93906399-93906421 GGCACGGTGGGGCCCAGAGCAGG + Intergenic
1058418040 9:104808287-104808309 GGCTCTGTAGGAGCCAGAACTGG - Intronic
1058647874 9:107147353-107147375 CATTGTGCAGGGCCCAGAGCGGG + Intergenic
1059182622 9:112232375-112232397 GACTCTGTAGGGCAGAAAACTGG - Intronic
1059439734 9:114300312-114300334 GACTTTGCAAGGCACAGAGCAGG - Intronic
1061176805 9:129002535-129002557 AAGTATGTAGGGGCCAGAGCAGG + Intronic
1061245941 9:129401390-129401412 GACCTAGCAGGGCCCAGAGCAGG - Intergenic
1061770952 9:132920893-132920915 GCCTCTGTAGGGCCCTGGGGAGG + Intronic
1062468657 9:136692522-136692544 GCCCCTGTAGGCGCCAGAGCCGG - Intergenic
1062698848 9:137888852-137888874 CCCTCTGTGGGGCCCTGAGCTGG - Intronic
1190144821 X:47880921-47880943 GACTCTGCAGGGTCCTGAGGTGG + Intronic
1194379246 X:93174654-93174676 GCCTTTGGAGGGCCAAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic