ID: 1148854393

View in Genome Browser
Species Human (GRCh38)
Location 17:50570797-50570819
Sequence ACAGAGAAGCTGAAGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 6, 3: 53, 4: 694}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148854386_1148854393 4 Left 1148854386 17:50570770-50570792 CCCTGAGGAATTGATCTCAGTTG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG 0: 1
1: 0
2: 6
3: 53
4: 694
1148854382_1148854393 28 Left 1148854382 17:50570746-50570768 CCGGTGTAATTCCCTTAATGCAA 0: 1
1: 0
2: 1
3: 5
4: 129
Right 1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG 0: 1
1: 0
2: 6
3: 53
4: 694
1148854385_1148854393 16 Left 1148854385 17:50570758-50570780 CCTTAATGCAAACCCTGAGGAAT 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG 0: 1
1: 0
2: 6
3: 53
4: 694
1148854384_1148854393 17 Left 1148854384 17:50570757-50570779 CCCTTAATGCAAACCCTGAGGAA 0: 1
1: 0
2: 0
3: 11
4: 177
Right 1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG 0: 1
1: 0
2: 6
3: 53
4: 694
1148854387_1148854393 3 Left 1148854387 17:50570771-50570793 CCTGAGGAATTGATCTCAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG 0: 1
1: 0
2: 6
3: 53
4: 694

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148854393 Original CRISPR ACAGAGAAGCTGAAGGGGGA TGG Intronic
900007579 1:73168-73190 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
900275188 1:1821297-1821319 ACAGAGTAGCTGATGGAGTAAGG - Intronic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900344109 1:2203070-2203092 GGAGAAAAGCAGAAGGGGGATGG - Intronic
900439369 1:2645705-2645727 ACAGAGAAGCAGGAAGGGGCAGG - Intronic
900525811 1:3128071-3128093 ACAGCGGGGCTGACGGGGGAGGG - Intronic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
900877109 1:5350635-5350657 AAGGAGAAGGTGGAGGGGGAGGG + Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901460500 1:9388428-9388450 ACAGAGAGGCTGAGGGGACAAGG - Intergenic
901657146 1:10775920-10775942 ACGGAGAGGCTGCAGCGGGAGGG - Intronic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902737955 1:18413664-18413686 ACAAAGAAGCTGAGGGGGCCAGG - Intergenic
903522486 1:23961443-23961465 ACAAAGAAGCTGAAGATGGGTGG + Exonic
903658122 1:24961145-24961167 TCAGAGAAACTGAGAGGGGAGGG + Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904346980 1:29879119-29879141 ACAGAGCAGGGGAAGGGGGAGGG - Intergenic
904442301 1:30539694-30539716 ACTTAGAGGCTAAAGGGGGAGGG - Intergenic
904585289 1:31576634-31576656 ACAGAGAAGAAACAGGGGGAGGG + Intronic
905121934 1:35688989-35689011 AAAGAGAAAGAGAAGGGGGATGG + Intergenic
905313073 1:37064091-37064113 AGAGAGGAGCAGAAGGGCGAGGG + Intergenic
905489408 1:38331916-38331938 ACTGGGAAGCTGGAGGGGAAGGG - Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
905663399 1:39746178-39746200 ACAGGGAAGATGAGGGGGCAGGG - Intronic
905731159 1:40300392-40300414 ACAGAGGCTCTGGAGGGGGAGGG - Intergenic
905976722 1:42180828-42180850 ACAGGGAAGCTGAGGTAGGAGGG + Intronic
906119283 1:43377513-43377535 ACAGGGGAGCTGCAGAGGGAAGG + Intergenic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192622 1:43907705-43907727 CCTGAGAAGGTGAAGGGAGATGG - Intronic
906214526 1:44031033-44031055 ACCAAGGAGCTGAAGCGGGAGGG - Intronic
906825239 1:48972232-48972254 GTAGGGAAGCTGAAGGGAGATGG + Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907951706 1:59189597-59189619 ACAGAGCAAGTGAATGGGGAGGG - Intergenic
908528262 1:65008664-65008686 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
909356027 1:74711183-74711205 ACACAGAATCTGAGGGGTGAGGG + Intronic
910014141 1:82500343-82500365 ACAGAGAACTTGCAGAGGGAAGG - Intergenic
910189813 1:84583934-84583956 GCCAAGAGGCTGAAGGGGGAGGG - Intergenic
910950947 1:92647681-92647703 AGAGGGAAGGTGAAGGGGGCAGG + Intronic
913163108 1:116163182-116163204 GCAGTGAAGCTGAGGGAGGATGG + Intergenic
913342972 1:117778499-117778521 ACAAAGAAGCTGAAGATGGGTGG - Intergenic
913661951 1:121012422-121012444 ACAGAGAACCTGAGGCAGGAGGG - Intergenic
914013328 1:143795607-143795629 ACAGAGAACCTGAGGCAGGAGGG - Intergenic
914164497 1:145165578-145165600 ACAGAGAACCTGAGGCAGGAGGG + Intergenic
914281324 1:146175920-146175942 AAAAAGAAGCTGAAGTGGTACGG + Intronic
914420350 1:147522942-147522964 TCTGAGAGGCTGAAGTGGGAGGG + Intergenic
914542369 1:148626855-148626877 AAAAAGAAGCTGAAGTGGTACGG + Intronic
914624266 1:149444390-149444412 AAAAAGAAGCTGAAGTGGTACGG - Intergenic
914651950 1:149704216-149704238 ACAGAGAACCTGAGGCAGGAGGG - Exonic
915225510 1:154408268-154408290 ACAGAGAGCCCGAAGCGGGAGGG - Intronic
915359687 1:155278342-155278364 ATAGGGACGCTGAAGGGGGCGGG + Intronic
915571787 1:156748877-156748899 AAAGAGAAGGTACAGGGGGAAGG + Intronic
915963903 1:160290058-160290080 GAAGAGTAGCTGCAGGGGGAAGG + Exonic
917717692 1:177754607-177754629 AGAGAGAAGGTGGAGGGAGAAGG + Intergenic
918596780 1:186303498-186303520 ACTGAGAAGCGGAAAAGGGAAGG + Intronic
919540486 1:198839328-198839350 CCATAGAAGATGAAGGTGGAGGG + Intergenic
919930938 1:202221263-202221285 AGAGAGCAGCTGAAAGGGGCTGG - Intronic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920228526 1:204455310-204455332 AGAGAGAAGGGGAAGGGGGTTGG + Intronic
920344782 1:205299152-205299174 GGCGAGAAGCTGAAGGGTGAGGG - Intergenic
920637250 1:207715802-207715824 ACTGGGAGGCTGAAGTGGGAGGG - Intronic
921097020 1:211895458-211895480 GCAGAGAAGAGGAAGAGGGAAGG - Intergenic
921227509 1:213035006-213035028 GCAGAGAAGGTCAAAGGGGAAGG + Intergenic
922022137 1:221716062-221716084 ACAGAGAAGGTGTAGGGAGAGGG - Intronic
923525742 1:234771324-234771346 ACAGAGACGCTGGAGGAGGCTGG + Intergenic
923621603 1:235583913-235583935 ACAGAGAAGCTGTAGGTGGTGGG - Intronic
923765863 1:236891857-236891879 ACAGAGAAGATGAAGGATGATGG + Intronic
923772657 1:236951067-236951089 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
923772680 1:236951224-236951246 ACAGAGAAAGGGAAGGAGGAAGG - Intergenic
923983398 1:239352381-239352403 ACAGAGAACCAGGAGAGGGAAGG - Intergenic
924637168 1:245799156-245799178 ACAGAGAGGTTGAAGGGAGAGGG + Intronic
1062838994 10:655155-655177 ACATAGAAGCTGATGGGGCTGGG - Intronic
1063884884 10:10567479-10567501 GCAGAGAAGCAGAATGGGGCGGG + Intergenic
1064628527 10:17285729-17285751 AGAGAGAAGGGAAAGGGGGAGGG + Intergenic
1065796370 10:29311960-29311982 AAAGGGAAGGGGAAGGGGGAGGG + Intronic
1066034255 10:31465907-31465929 ACAGATAAGATGAAAGAGGAAGG + Intronic
1066230725 10:33430259-33430281 ACAGAAAAGCTGAAGGTGCCTGG - Intergenic
1067080540 10:43209957-43209979 ACTGAGAGGCTGTAGGGGAAGGG - Intronic
1068688134 10:59889905-59889927 GCTGAGAAGCTGAAGTGGGGTGG - Intronic
1068962064 10:62877038-62877060 ACAGGGAGGCTGCAGGGGAAGGG - Intronic
1069029504 10:63580377-63580399 TCTGAGAAGCTGAAGTGGGAAGG - Intronic
1069511283 10:69044371-69044393 ACAGAGAAGCTGTGGAGGGAAGG - Intergenic
1069820684 10:71225787-71225809 AGAGAGAAGCTCAAGTTGGAAGG + Intronic
1069987053 10:72291747-72291769 AGAGATGAGCTGAAGAGGGAGGG + Intergenic
1070499077 10:77053454-77053476 CCAGAGACGCTGAAGGGGTTGGG + Intronic
1070720014 10:78749885-78749907 ACAGAGAATATGAAAGTGGATGG - Intergenic
1070813655 10:79310714-79310736 TCAGGGAGGCTGCAGGGGGACGG - Intronic
1070843362 10:79503322-79503344 AGAGAGAAGGTGGAGGGTGAGGG - Intergenic
1071254634 10:83860719-83860741 ACTCAGAAGCTGTAGGGGTAGGG - Intergenic
1071972377 10:90921226-90921248 TCTGGGAAGCTGAAGAGGGAGGG + Exonic
1072478943 10:95792035-95792057 ACAGAGAAGCTTAGAGGAGAGGG + Intronic
1073152911 10:101323835-101323857 ACAAAGAAGCTGAAGAGGTAGGG - Intergenic
1073186763 10:101619669-101619691 AAAAAGAAGAGGAAGGGGGAAGG + Intronic
1073275930 10:102311377-102311399 AAAGAGAAGCTGCAGGGGATGGG + Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073325876 10:102643848-102643870 AAATAGAAACGGAAGGGGGAGGG - Intergenic
1073842155 10:107510058-107510080 ACAGAGCAGGTGTAAGGGGATGG + Intergenic
1073956196 10:108874288-108874310 ATAGAGGTGCTGGAGGGGGAGGG - Intergenic
1074108817 10:110408427-110408449 ACTGAGGAGGGGAAGGGGGAGGG - Intergenic
1074330910 10:112508124-112508146 TCAGAGAAGCAGAAGAGGCAGGG - Intronic
1074594927 10:114853954-114853976 AAGGAGAATCTGAAGAGGGAAGG + Intronic
1075197978 10:120377779-120377801 AGAGAGGAGCAGAAGGGGAAGGG - Intergenic
1075263834 10:120984277-120984299 ACAGAGCAGCAGAACGGGGTTGG - Intergenic
1076792562 10:132785064-132785086 GCCGAGAAGCTGAAGGTGGGCGG - Exonic
1077419161 11:2441507-2441529 TCCAAGGAGCTGAAGGGGGATGG - Intergenic
1077610142 11:3638967-3638989 TCAAAGCAGCTGAAGGAGGATGG + Intronic
1078539568 11:12202214-12202236 AGAAAGAAGCTCAAGGTGGATGG - Intronic
1079206155 11:18416723-18416745 ACGGAGAAGGGAAAGGGGGAAGG - Intronic
1080044322 11:27792911-27792933 GGAGAGAAGCTGAACAGGGAAGG + Intergenic
1080306150 11:30839020-30839042 TCAGAGAAACTCAACGGGGATGG + Intronic
1080556321 11:33420682-33420704 AAAGAGAAGCTGAATGGCCATGG + Intergenic
1081520210 11:43874109-43874131 GAAGAGACCCTGAAGGGGGAAGG - Intergenic
1081541146 11:44035640-44035662 AAAGAATAGCTGAAGGGGCAGGG + Intergenic
1081992191 11:47343737-47343759 ACAGAGAAGTGGAAGCGGGGCGG - Intronic
1082013710 11:47468802-47468824 TCAGAGAAGCTGAAGAGACAGGG + Intronic
1082954102 11:58850539-58850561 AGATAGGAGCTGAAGGGGCATGG + Intronic
1083203751 11:61135119-61135141 ACAGAGAAGCTGCACAGTGAGGG - Intronic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1083909371 11:65697071-65697093 CCATGGAAGCTAAAGGGGGATGG - Intergenic
1084217768 11:67659666-67659688 AGATAGGAGCTGAAGGGGCACGG - Intergenic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1084935598 11:72584936-72584958 ACAGAGCAGCTGTGGAGGGAGGG + Exonic
1085309320 11:75506910-75506932 ACAGAGAAGGGGAGGGGGGCAGG - Intronic
1085537515 11:77232084-77232106 TCAGAGAAGCCTAAGAGGGAAGG - Intronic
1085816337 11:79741336-79741358 GGAGAGAATGTGAAGGGGGAAGG - Intergenic
1086590378 11:88508713-88508735 ACCGAGTCTCTGAAGGGGGACGG + Exonic
1086595901 11:88570041-88570063 AAAGAGAAGGGGAAGGGGAAAGG + Intronic
1086922869 11:92606985-92607007 ACAGAGAAGATGAAGATGCAGGG - Intronic
1087423561 11:97963632-97963654 ATAGACAAGCTGAAGGGGAGTGG + Intergenic
1087599728 11:100298041-100298063 AGAGTGGAGATGAAGGGGGAGGG + Intronic
1087985317 11:104671561-104671583 TCAGAGAAGCTGAAGGATGCAGG - Intergenic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088944600 11:114496417-114496439 AAAGAGAAACTGAAGAGGGTAGG - Intergenic
1089266302 11:117264726-117264748 ATAGAAAGGCTGAAGGGGAAAGG - Intronic
1089500960 11:118930884-118930906 GGAGAGAAGCTGAAGGGGGTTGG - Intronic
1089518915 11:119051126-119051148 ACAGTGAAGCTAAAAGGGGTGGG - Exonic
1090421456 11:126578267-126578289 GCAGAGAAGCTGGAGGGGAGAGG - Intronic
1090500237 11:127254146-127254168 ACCCAGAAGCCGAAGGTGGAGGG - Intergenic
1090943501 11:131409527-131409549 GCAGAGAAGCTGAAAGGGCCAGG - Intronic
1091059268 11:132446319-132446341 ACAGAGAGGCAGAGGAGGGAGGG + Intronic
1091345716 11:134852521-134852543 ACAGAGAGGGTGACGGGAGAGGG - Intergenic
1091530555 12:1350850-1350872 GCAGAGAAGGTCAAAGGGGAAGG + Intronic
1091541683 12:1468256-1468278 ACAGAAAAGCTGCAGGGGGAAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1092148776 12:6232806-6232828 ACAGAACAGATGGAGGGGGATGG + Intronic
1092380937 12:7996571-7996593 CCAGAGAATGTGACGGGGGAAGG - Intergenic
1093369236 12:18346775-18346797 ACTGTGAAGCTGAGGTGGGAAGG - Exonic
1093421485 12:18979347-18979369 ACAGAGATGGGGAAGGGGAAAGG - Intergenic
1094059655 12:26300260-26300282 AGAGAGAAGAGGAAGGAGGAGGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095170286 12:39026879-39026901 ACAGGGAAGCAGAAGAGAGATGG + Intergenic
1096045516 12:48558802-48558824 ACAGAAATGCTGAAATGGGAAGG + Intergenic
1096570294 12:52519244-52519266 ACAGAAAAGCTTTAGAGGGACGG - Intronic
1096729982 12:53601660-53601682 AAATAGAATCAGAAGGGGGAAGG - Intronic
1096823955 12:54259891-54259913 ACAGCTCAACTGAAGGGGGAGGG + Intronic
1097125349 12:56770173-56770195 AAAGAGAAGATGGTGGGGGAGGG + Intronic
1097734021 12:63162355-63162377 CCAAAGAAACTGAAGGAGGAGGG + Intergenic
1097754153 12:63390375-63390397 ACACAGAAGCTGATGGCTGATGG - Intergenic
1098059162 12:66541486-66541508 GCAGACAAGCTGCAGTGGGAAGG - Intronic
1098291210 12:68958427-68958449 ACAGAAAAGCTGGGGGTGGAGGG - Intronic
1098298360 12:69027821-69027843 AAATAGTAGCTGGAGGGGGATGG - Intergenic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099147522 12:79065274-79065296 CTAGGGAAGCTGAAGTGGGAGGG + Intronic
1099355119 12:81624812-81624834 TCAGAGACTCAGAAGGGGGAGGG + Intronic
1099549884 12:84030663-84030685 ACTCAGAAGGTGAAGTGGGAAGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1102408779 12:112698873-112698895 AAAGGGAAGCGGAAGGGGAAGGG - Intronic
1102706236 12:114883405-114883427 ACAGAGAAGCCGAAGATGAAAGG - Intergenic
1102904929 12:116667187-116667209 ACTGACAAGCTGAAGGTAGAAGG + Intergenic
1103461168 12:121106370-121106392 AAAGAGATGCTGAAGAGGGCAGG + Intergenic
1104948256 12:132427133-132427155 ACTGAGAAGCTGATGTTGGAAGG + Intergenic
1105376325 13:19848522-19848544 ACAAAGAGGCTGAGGTGGGAGGG - Intronic
1105379913 13:19877261-19877283 GCTGAGAAGTTGAAGGGGCATGG + Intergenic
1106708179 13:32303507-32303529 ATAGAGATGATGAAGGGGCAAGG - Intergenic
1106747980 13:32724222-32724244 ACTGAGAGGCTGAGGTGGGATGG - Intronic
1107091102 13:36481018-36481040 ACAGAGTGGCTGAATGGAGAAGG + Intergenic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107664312 13:42673248-42673270 CCAGAGAAGCTGAGAAGGGATGG - Intergenic
1107686598 13:42906600-42906622 ACAGAAAAGCTTTCGGGGGAAGG + Intronic
1108070460 13:46623852-46623874 ACAGAGATGGGGAGGGGGGAGGG - Intronic
1108519836 13:51236374-51236396 ACTGAGAAACTAAAGGGAGAAGG - Intronic
1109432137 13:62249945-62249967 ACAGAGAAACTGAAATGCGATGG - Intergenic
1109752001 13:66706667-66706689 ACTGAGAAGCTAAGAGGGGAAGG + Intronic
1110470372 13:75853344-75853366 ACTGTGAAGCTGAAGGGGAATGG - Exonic
1111107937 13:83670202-83670224 ACAGAGCAGCAGAAGAGAGAAGG - Intergenic
1111815507 13:93147818-93147840 ACTGAGAAGCTGAGGAGGGGTGG + Intergenic
1112286119 13:98105878-98105900 ACAGACACACTGAAGGGTGAGGG + Intergenic
1113603744 13:111590064-111590086 ACAGAGCAGATGAATGGCGATGG + Intronic
1114127288 14:19743704-19743726 ACAGAGGAGCAGGAAGGGGAGGG - Intronic
1114243619 14:20892280-20892302 TCAGGAAAGCTGAAGGGGTATGG - Exonic
1114250545 14:20956368-20956390 TCAGGAAAGCTGAAGGGGTATGG - Exonic
1115255453 14:31396296-31396318 ACTGAGAGGCTGAGGTGGGAGGG + Intronic
1115314849 14:32014854-32014876 ACAGGGAAGCTGCAGGAAGAAGG - Intronic
1115384514 14:32780358-32780380 ACAGAGAATCTGAAGGGAAATGG + Intronic
1115633166 14:35265823-35265845 ATAGAGAGGCTCAAGAGGGATGG - Intronic
1115955566 14:38775282-38775304 ACAGAAATGCTGGAGGAGGAGGG - Intergenic
1116118693 14:40694036-40694058 ACAGAAAAGCTGATGGGGCAGGG + Intergenic
1116256390 14:42562049-42562071 ACAGACACACTGAAGGGTGAGGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117474278 14:56078171-56078193 ACAGAGAATGGGAAGAGGGAAGG - Intergenic
1117993036 14:61453635-61453657 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
1118066013 14:62190737-62190759 GCTGAGAAGCTGAACTGGGAAGG - Intergenic
1118586692 14:67359970-67359992 GCAGGGAAGCTGGATGGGGAGGG - Exonic
1118745657 14:68771205-68771227 ACAGAGAAGGTGATGGTGGGAGG - Intergenic
1119216943 14:72876403-72876425 AAAGAGAGGCTCCAGGGGGAGGG - Intronic
1119408036 14:74410948-74410970 TCAAAGCAGCTGAAGGAGGAAGG - Intronic
1119657414 14:76427013-76427035 ACAGAGATGCTGCAGGGGCATGG + Intronic
1120168041 14:81220954-81220976 AGAGACAGGGTGAAGGGGGAGGG + Intronic
1120850501 14:89164860-89164882 ACATAGAAAGTGAAAGGGGAAGG + Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121489818 14:94349766-94349788 ACAGAGAAGCTGAGAAGGGAAGG + Intergenic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1122392786 14:101401797-101401819 AAAGAGAAGGAGAAGGGGAAGGG - Intergenic
1122411520 14:101528377-101528399 TCAGAGAAGGTAAGGGGGGACGG + Intergenic
1122897951 14:104769632-104769654 ACACAGAAGGGGAAGGGGGAGGG + Exonic
1123062865 14:105602078-105602100 AGAGAGAGTTTGAAGGGGGAGGG - Intergenic
1202904417 14_GL000194v1_random:60079-60101 AGAGAGGAGGTGAAGGTGGAAGG - Intergenic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123570744 15:21605343-21605365 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123606857 15:22040696-22040718 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1123817997 15:23999079-23999101 ACTGAGAGCCTCAAGGGGGAGGG + Intergenic
1123966816 15:25467664-25467686 ACAGAGAAGCTCAAGGAGCTGGG + Intergenic
1124137359 15:27046612-27046634 ACAGAGCAACAGAAGTGGGAAGG - Intronic
1124647658 15:31450396-31450418 AGAGAGAGGCTTAAGGGGGAAGG + Intergenic
1124943308 15:34238784-34238806 AATGTGAAGCTGAAGGGGGTAGG + Intronic
1126372301 15:47960314-47960336 ACAGAGAAGCTGAAGGTATGAGG - Intergenic
1126430951 15:48583770-48583792 AAAGAGAAAATGAAGGGGTAAGG - Intronic
1126554745 15:49973174-49973196 ACAGATCAGGGGAAGGGGGATGG + Intronic
1127415044 15:58749597-58749619 AGGGAGAAGCTGAAGGGGCTTGG + Exonic
1127973018 15:63977101-63977123 AAAGAGAAGGGGAAGGGGGAAGG + Intronic
1128375965 15:67076241-67076263 ATAGAGAAGGTGATGGGGGAGGG - Intronic
1128458065 15:67844080-67844102 AAAGTTAAGCTGAAGGGGGGTGG + Intergenic
1129002623 15:72346923-72346945 ACAGGGAGGCTGCAGAGGGACGG - Intronic
1129223250 15:74147525-74147547 AAAGAGAAGCTGAAGAGAGAGGG - Intergenic
1129466284 15:75725954-75725976 CCACAGAATCTGAAGTGGGAGGG + Intronic
1130862477 15:87903407-87903429 ACAGGGAAGATGATGGAGGAGGG - Intronic
1131098910 15:89672949-89672971 CCAGAGAATCTGCAGGGGAAGGG - Intronic
1131297146 15:91159188-91159210 ACAGAGAAGCTGAGGTGGTGGGG - Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131541738 15:93280406-93280428 ACGGAGGAGGCGAAGGGGGAGGG + Intergenic
1131907838 15:97163571-97163593 ACACAGAAAATGAAGTGGGAAGG - Intergenic
1131951222 15:97683707-97683729 AAAGAGAAGGGGGAGGGGGAGGG + Intergenic
1132445971 15:101918944-101918966 ACAGAGTAGCAGAGGGAGGATGG + Intergenic
1202979097 15_KI270727v1_random:332466-332488 ACAGAGGAGCAGGAAGGGGAGGG - Intergenic
1132598723 16:764633-764655 ACAGCGCAGCTGCAGGGGCAGGG - Exonic
1132854633 16:2039269-2039291 ACAGGGAAGGTGAAGGTGGGAGG - Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1134031208 16:10993892-10993914 ACAGAGAAGGTGACCTGGGATGG + Intronic
1134401529 16:13914501-13914523 GGGGAGAGGCTGAAGGGGGAGGG - Intergenic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134849582 16:17469822-17469844 ACAGAGAAGGTGAAGACGGAAGG + Intronic
1135881607 16:26263175-26263197 GCAGAGAAGATCAAAGGGGAAGG + Intergenic
1135904166 16:26495500-26495522 ACAGAGACTCAGAAGGGTGAAGG + Intergenic
1135927598 16:26709298-26709320 TCAGAGAAGGTTAAGGGGGTGGG + Intergenic
1135943554 16:26843665-26843687 CAAAAGAAGCTGAAGGGGGCTGG - Intergenic
1136060559 16:27723481-27723503 CCAGAGAAGCGCAAGGGGCAGGG - Intronic
1136407721 16:30058284-30058306 ACAAGGAAACTGAAGAGGGAGGG - Intronic
1137872922 16:51967800-51967822 AAAGTGAAGCTGAAAGGAGAAGG - Intergenic
1137878577 16:52021914-52021936 GTAGAGAAGATGAAGGGGAAAGG - Intronic
1138160112 16:54745375-54745397 ACAAAGAAGCTGAAAAGGGAAGG + Intergenic
1139149239 16:64360481-64360503 TCAGAGAAGGCGAAGTGGGAAGG + Intergenic
1139278306 16:65748463-65748485 ACAGTGAAGCTGGAGAGGAAAGG - Intergenic
1139338947 16:66254574-66254596 ATAGAGAAAGTGAAGGGGGGAGG - Intergenic
1139603412 16:68000801-68000823 ACAGAGAGGCTGGCGGGGTAGGG - Intronic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1140043442 16:71424640-71424662 CCAGAGAAGCTATAGAGGGAAGG - Intergenic
1140457072 16:75111809-75111831 ACAGAGACCCTGGAGGGGGAGGG + Intergenic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140790600 16:78387573-78387595 GGAGAGAAGCGGAAGGGGGTGGG + Intronic
1141240623 16:82262017-82262039 CCAGAGGGGCTAAAGGGGGAAGG + Intergenic
1141382557 16:83589231-83589253 AGAGAGAAGAGGGAGGGGGATGG - Intronic
1141704492 16:85657273-85657295 ACAGAGAAGCTGAAGGATGCCGG + Exonic
1142259341 16:89035345-89035367 ACAGCGATGCTGCAGGGGGAGGG + Intergenic
1142492203 17:286404-286426 ACACTGAAGCAGCAGGGGGATGG - Intronic
1142641550 17:1288515-1288537 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641602 17:1288641-1288663 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142641670 17:1288786-1288808 GATGAGAAGCTGGAGGGGGATGG - Intronic
1142758304 17:2028626-2028648 CCAGAGAAGCTGGGGGGAGATGG + Intergenic
1142894338 17:2964326-2964348 ACAGAGGAGCTGGCGGGGGTGGG + Intronic
1143108774 17:4542245-4542267 ACACAGGAGCTGAGGGGGCAGGG - Intronic
1143111272 17:4554354-4554376 TGGGAGAAGTTGAAGGGGGAAGG - Intronic
1143171370 17:4932508-4932530 GAAGCGAAGCTGCAGGGGGAAGG + Intronic
1143699070 17:8644187-8644209 TCAGAGAAGCTTCAGGGCGAAGG - Intergenic
1143778795 17:9218579-9218601 ACAGTGACGCTGAAGGGACAGGG + Intronic
1143947430 17:10605472-10605494 AAAGAGAAGGAGGAGGGGGAGGG + Intergenic
1144098624 17:11924137-11924159 ACAGAGCAGGTGAGGGGAGAAGG - Intronic
1144300508 17:13919329-13919351 AGTGAGAAGGGGAAGGGGGAAGG - Intergenic
1144724261 17:17493821-17493843 ACAGCAAGGCTGAAGGGGGATGG + Intergenic
1144944388 17:18962292-18962314 ACAGGGATACTGATGGGGGATGG + Intronic
1145265316 17:21377023-21377045 ACAGGGAAGGTGGAGCGGGAGGG + Intronic
1145293055 17:21565109-21565131 ACAGAGGAGCTGAAGTGGACAGG - Intronic
1145386913 17:22420817-22420839 ACAGAGGAGCTGAAGTGGACAGG + Intergenic
1146211438 17:30946630-30946652 ACAGAGATGCTGAGTGGGGGTGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146637284 17:34515733-34515755 AAAGAGAAGCTGAAAGAGAAAGG - Intergenic
1146768762 17:35548811-35548833 ACTGAGCAGATGGAGGGGGAAGG + Exonic
1146946226 17:36875581-36875603 AGAGAGAAGCAGAAGTGGAAAGG + Intergenic
1147126672 17:38374643-38374665 AAAAAGAAGGTGAAGGGTGAAGG + Intronic
1147307214 17:39572513-39572535 AAAGGGCAGCTGAAGGGAGATGG - Intergenic
1147317186 17:39626695-39626717 GCAGAGAGGATAAAGGGGGAGGG - Intergenic
1147321878 17:39651544-39651566 TCAGAGGAGCTGAAGCGGGGAGG - Intronic
1147490297 17:40859769-40859791 TCAAAGAAGCAGAAGGGAGAGGG - Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148860681 17:50602880-50602902 ACAGTGAAGGTGATGGGGGCTGG + Exonic
1149002968 17:51775896-51775918 ACAGAGAAACAGAAGGGGAATGG + Intronic
1149085943 17:52716121-52716143 ACAGAGAAGCTGAATATGTATGG - Intergenic
1149376983 17:56054008-56054030 TCAGAGAATCAGAAGAGGGAGGG - Intergenic
1151062196 17:71108472-71108494 ACTGGGAAACTGAAGTGGGAGGG - Intergenic
1151332822 17:73421073-73421095 ACAGAGAGGCTGAAAGTGTAGGG - Intronic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1152084062 17:78206652-78206674 AGAAAGAAGATGAAGGAGGAAGG - Intronic
1152609237 17:81307485-81307507 AAAGGGAAAGTGAAGGGGGAGGG - Intergenic
1153499025 18:5729632-5729654 AAAGAGGAGGTGGAGGGGGAAGG - Intergenic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156215208 18:34990969-34990991 ACAGATAATCTGATGGGGGGAGG + Intronic
1156400372 18:36734018-36734040 AGAGGGAATCTGAAAGGGGAGGG + Intronic
1156453070 18:37277484-37277506 AGAGAAAAGCTGAAGTGGGATGG + Intronic
1156912506 18:42426977-42426999 AAAGAGAAACTGAAGGGGGTAGG - Intergenic
1157194599 18:45610557-45610579 ACACTGAAGCTGAAAGGGAAGGG + Intronic
1158208519 18:55021168-55021190 ACAGAAAATGTGAAGTGGGAGGG - Intergenic
1158337907 18:56433751-56433773 ACAGGGAAGGTGCAGGGGCAGGG + Intergenic
1159624686 18:70679028-70679050 AAAGAGAAGAGGAAGGGGAAGGG - Intergenic
1159947939 18:74457634-74457656 TCAGAGAAGTTGGTGGGGGAGGG - Intronic
1160239423 18:77112553-77112575 ACAGAGAAGGGGGAGGGGGAGGG - Intronic
1160639336 19:114763-114785 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1160918063 19:1507088-1507110 ACAGAGCATCAGAGGGGGGAGGG - Intronic
1161032052 19:2062071-2062093 ACAGAGGAGCTGGGGGGGGTTGG + Intergenic
1162081459 19:8220287-8220309 AGAGGGAGGCTGAAGGTGGAGGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1162513100 19:11131613-11131635 ACATGGAAGATGAAAGGGGAGGG + Exonic
1162800900 19:13109941-13109963 GCCGAGACGCTGAAGGTGGAAGG + Exonic
1162856480 19:13472388-13472410 TCAGAGAAGCTTAAGTGGGATGG - Intronic
1162861249 19:13506969-13506991 ACAAAGAAGATGAAAGGGAAGGG + Intronic
1163075702 19:14889075-14889097 AGATAGGAGCTGAAGGGGCATGG - Intergenic
1163455446 19:17403577-17403599 AGAGAGAGGCTGCAGGGGAAGGG - Intronic
1163648611 19:18504191-18504213 ACAGAGAGGCTGGAGGGGTGAGG + Intronic
1164324770 19:24181446-24181468 ACAGAGGAGAAAAAGGGGGAGGG + Intergenic
1164335919 19:24321266-24321288 AAGGAGTAGCTGAAGGGAGAGGG - Intergenic
1164518270 19:28955239-28955261 AGAGAGAAGATGAACAGGGAGGG - Intergenic
1164655029 19:29914639-29914661 ACTGGAAAGCTGAAGGGGCAGGG + Intergenic
1164667543 19:30051517-30051539 ACAGAAAAGGAGGAGGGGGAAGG - Intergenic
1165363845 19:35352092-35352114 AGAGAGAGGCTGAAGCGGGCCGG - Exonic
1166034961 19:40161420-40161442 GAAGAGAAGCAGAAGGGGAAGGG + Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166177980 19:41088273-41088295 CCAGGGAAGCTGAACAGGGAGGG - Intergenic
1166301595 19:41914548-41914570 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301609 19:41914608-41914630 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301622 19:41914668-41914690 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301629 19:41914695-41914717 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301636 19:41914722-41914744 ACAGAGATGGTGGAAGGGGAGGG - Intronic
1166301643 19:41914749-41914771 ACAGAGACGGTGGAAGGGGAGGG - Intronic
1166301650 19:41914776-41914798 ACAGAGACGGTGGAAGGGGAGGG - Intronic
1166301687 19:41914908-41914930 ACGGAGATGGTGGAGGGGGAGGG - Intronic
1166301702 19:41914972-41914994 ACAGAGATGCTGGAGGGGGAGGG - Intronic
1166878676 19:45913930-45913952 ACAGAGAAGTCGAAGGGGCAGGG + Exonic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167058997 19:47131576-47131598 TCGGAGAGGCTGGAGGGGGACGG + Intronic
1167227820 19:48260368-48260390 AGATAGGAGCTGAAGGGGCACGG - Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167552285 19:50169485-50169507 ACAGAGACCCAGAAGGGGGAGGG - Intergenic
1167980810 19:53273223-53273245 ACAGGGGAGATGAAGGAGGAGGG + Intergenic
925078154 2:1037161-1037183 AGAGAGAAGCAGAAGGCAGATGG - Intronic
925090170 2:1148808-1148830 GGAGAGAAGGTGAAGGTGGAGGG + Intronic
925379649 2:3416488-3416510 ACAGTGAAGGGGTAGGGGGAGGG - Intronic
925379667 2:3416534-3416556 ACAGTGAAGAGGCAGGGGGAGGG - Intronic
925379674 2:3416558-3416580 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379691 2:3416605-3416627 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379708 2:3416652-3416674 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379733 2:3416722-3416744 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379751 2:3416768-3416790 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379760 2:3416792-3416814 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379778 2:3416838-3416860 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379787 2:3416862-3416884 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379796 2:3416886-3416908 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925379805 2:3416910-3416932 ACAGTGAAGGGGCAGGGGGAGGG - Intronic
925607618 2:5674384-5674406 ACAGAGAAGCAGAAAAGGAATGG - Intergenic
926116627 2:10217676-10217698 ACACATAAGCTGCAGGGGGCTGG - Intergenic
926425903 2:12738480-12738502 GCAGAGAAGGTGAGGAGGGATGG - Intronic
927123058 2:19986682-19986704 CCTGAGAAGGTGAAGGGAGATGG + Intronic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
927805322 2:26141708-26141730 CCAGAGGAGTTGTAGGGGGAGGG - Intergenic
928115872 2:28544900-28544922 ACAGAGAAGCTGGAGAGGGCAGG + Intronic
928284660 2:29979345-29979367 ACAGAAAAGCACAAGGGAGAAGG + Intergenic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929901583 2:46008386-46008408 AGAAAGAAGATGAAGGGGCAGGG + Intronic
930302208 2:49630634-49630656 AGAGAGAAGGGGAAGGGGAAAGG + Intergenic
931473232 2:62561519-62561541 CCAGGGAAGTTGAAGGGGGAGGG - Intergenic
932123958 2:69126633-69126655 ACAGAGCAGAGGAAGTGGGAAGG + Intronic
932180510 2:69642749-69642771 ACAGGGCAAGTGAAGGGGGAAGG + Intronic
932423167 2:71613135-71613157 ACAGAGCATGTGAAGGAGGATGG + Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932719779 2:74130675-74130697 ACAGAGAAGGTGGAGATGGAGGG - Exonic
933394518 2:81713747-81713769 ACAGAGAAAGTGAATAGGGATGG - Intergenic
933511436 2:83246044-83246066 TCACAGGAGCTGACGGGGGAGGG + Intergenic
934053243 2:88227793-88227815 ACAGGGAAGCTGCTGGGAGATGG + Intergenic
934485840 2:94709048-94709070 AGAGAGAGAGTGAAGGGGGAGGG + Intergenic
934946049 2:98542814-98542836 ACAGGGTAACAGAAGGGGGAAGG - Intronic
935669251 2:105541405-105541427 ACAGAGAGGGTCATGGGGGAAGG - Intergenic
936809803 2:116384366-116384388 ACAGAAAAGCAGTAGGGGGCTGG + Intergenic
937258098 2:120568885-120568907 ACAGAGAAGGGGCAGTGGGAGGG - Intergenic
937514653 2:122639567-122639589 AAACAGAATTTGAAGGGGGATGG + Intergenic
938196858 2:129335979-129336001 ACAGAAAAGCTGGAGGGGTCTGG - Intergenic
938314730 2:130317750-130317772 ACTGAGAGGGTGCAGGGGGAGGG - Intergenic
941381364 2:164796729-164796751 AGAGGGAAGGTCAAGGGGGAAGG + Intronic
941460576 2:165766675-165766697 GCAGAGGAACTGAAGGGTGATGG - Intronic
942632941 2:177971636-177971658 AGAGAGAAGGAGATGGGGGAAGG + Intronic
943138496 2:183947150-183947172 ACAGAAAAGTTGAAGGGGGTTGG - Intergenic
943405219 2:187474288-187474310 ACAGAGAAGCATATGGGTGAAGG + Intronic
943576691 2:189638748-189638770 ACAGAGATGCAGAAAAGGGATGG - Intergenic
943716608 2:191159632-191159654 ACAAAGTAGGTGAAGGGAGATGG + Intergenic
943731374 2:191306663-191306685 ACAGAAAAGGTGAAGAGAGAGGG + Intronic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
946640475 2:221778359-221778381 ACACAGAAGTTGTAGGCGGAGGG + Intergenic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
947165216 2:227254940-227254962 AGAGAGAAGCAGAAGTGAGATGG - Intronic
947210738 2:227706335-227706357 ACACAGAAAATGAAGGGGAAAGG - Intronic
947298202 2:228656677-228656699 ACAGAGAATCTCAAAGGGGCTGG + Intergenic
947353707 2:229271529-229271551 ACAGACTGGCTGAGGGGGGAAGG + Intergenic
947375345 2:229489696-229489718 GGAGAGCAGCTGAAGAGGGAGGG + Intronic
948012568 2:234661712-234661734 ACAGAGACCCTGAAGCAGGAAGG + Intergenic
948082417 2:235217197-235217219 ACACAGAAAATGCAGGGGGAGGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948513924 2:238491054-238491076 AGCGAGTAGCTGAAGGGGAAGGG - Intergenic
1169024156 20:2353370-2353392 ACAGAGAAGAGAAAGGGGGAGGG - Intergenic
1169502911 20:6178177-6178199 ACAGAGACACAGAAGGAGGATGG + Intergenic
1169541089 20:6600496-6600518 AGAGAAAAGCAGAAGGGGGTAGG + Intergenic
1170379842 20:15745813-15745835 GCACAGAAGCTGATGGGGAAAGG - Intronic
1170574564 20:17652665-17652687 CCAGAGAAGCTGGAGTGGGCAGG + Intronic
1170807174 20:19642449-19642471 ACACAGTACCTGAAGGGTGAAGG + Intronic
1170815038 20:19706656-19706678 ACAGAGAAGCTGCATGGTAAAGG + Intronic
1171124648 20:22591084-22591106 TCAGAGCAGCTGAGAGGGGAAGG - Intergenic
1172395917 20:34605037-34605059 ACCGAGAAGCTGAAGCTGTAAGG - Intronic
1172397570 20:34619907-34619929 ACATGGGAGCTGAAGGGTGAAGG - Intronic
1172540012 20:35705312-35705334 ACAGAGAAGAAGAAGTTGGATGG - Exonic
1173385267 20:42581807-42581829 ACTCAGAGGTTGAAGGGGGAGGG + Intronic
1173501934 20:43560076-43560098 ACAGTCAAGGTGATGGGGGAGGG + Intronic
1175486404 20:59349955-59349977 AGAGAGAAACTGGAGAGGGAAGG + Intergenic
1175674481 20:60934946-60934968 ACAGGGAGGCGGAAAGGGGAGGG - Intergenic
1175858976 20:62139489-62139511 ACAAAGCAGTTGAAGGGGGCTGG - Intronic
1175863888 20:62164283-62164305 GCAGAGCAGCTGCAGGGGCAAGG + Intronic
1176234056 20:64046019-64046041 ACAGACACGCTGAAGAGGGCAGG - Intronic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1178882185 21:36458621-36458643 ACAGAGAAGCTGAGGAGGCTGGG - Intergenic
1178924522 21:36763678-36763700 ACATAGGAGCTGCTGGGGGAGGG + Intronic
1179081959 21:38179571-38179593 ACAGGGAAGCTGACAAGGGAAGG + Intronic
1179305091 21:40146289-40146311 TCAGAGAAGTAGAAGGAGGATGG + Intronic
1180637516 22:17272698-17272720 CCAGAGAAAATGAAGGGGGAGGG - Intergenic
1180709837 22:17832153-17832175 ACTGAGAAGGGGAAGGGGAAGGG + Intronic
1181513179 22:23397853-23397875 GCAGAGAAGTTGATGGGGAACGG + Intergenic
1181636013 22:24175238-24175260 GCAGAGCAGCTGGATGGGGATGG + Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181756540 22:25028575-25028597 ACAGGGGAGCTGACCGGGGAAGG - Exonic
1181997422 22:26893713-26893735 ACAGAGAAGAGGAGAGGGGAAGG + Intergenic
1182359838 22:29739965-29739987 ACAGAGAAGCTTAAGGGGGCAGG + Intronic
1182704806 22:32270445-32270467 AAAGAGAATCCCAAGGGGGAGGG + Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183098490 22:35568944-35568966 ACAGAGCAGCTGAAGTGGTCAGG + Intergenic
1183256600 22:36766347-36766369 CGAGAGAAGATGAAGGGGAAAGG + Intronic
1183550925 22:38484499-38484521 ACAATGCAGTTGAAGGGGGAAGG - Exonic
1184281754 22:43441410-43441432 TCACAGAAGCTGCAGGAGGAAGG - Intronic
1184538151 22:45101532-45101554 ACAGAGTGGGTGAGGGGGGAGGG - Intergenic
1185191395 22:49438706-49438728 TCACAGAAGATGAAGGGCGAGGG - Intronic
1185294242 22:50045543-50045565 ACAGAGACACTGCAGGGAGAAGG - Intronic
1185328700 22:50241200-50241222 AGACAGGAGCTGAAGGGGCAAGG + Intronic
949122397 3:402417-402439 AGAGAGTAGCAGAAAGGGGAAGG - Intronic
949937416 3:9126758-9126780 ACAGAGACTCAGAAGGGTGAGGG + Intronic
951552360 3:23886638-23886660 ACAGAAGAGATGAAGAGGGAGGG - Intronic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
952218680 3:31302805-31302827 ACAGAGAAGAGGAAAGGGCAGGG - Intergenic
953006002 3:38979929-38979951 GCAAAGAAGCTGAATGGGCAGGG - Intergenic
953090977 3:39725897-39725919 ACAGAGATGCTGAAGTGAGCTGG + Intergenic
953350535 3:42212181-42212203 ACAGATAAGCTTCATGGGGAAGG + Intronic
953717349 3:45326787-45326809 GCAGAGAAGCTGTAGGTGGAAGG + Intergenic
953860766 3:46542386-46542408 ACAGAGAAGGCTAAGGTGGAAGG + Intronic
957019429 3:75108410-75108432 AGAGAGAAGGGGAAGGGGAAGGG + Intergenic
957672946 3:83328656-83328678 AAAGGGAAGGGGAAGGGGGAGGG + Intergenic
957711221 3:83861348-83861370 AAAGAGAAGCTGATAAGGGATGG - Intergenic
957810599 3:85215990-85216012 AAAGAGACACTGAAGAGGGAAGG - Intronic
958772113 3:98437391-98437413 AAAAGAAAGCTGAAGGGGGAGGG + Intergenic
959080337 3:101794219-101794241 ATAGAGAAGCTGAAGGGGGGAGG + Intronic
959871709 3:111336507-111336529 ACAGAAAATCTGAACAGGGAGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960734756 3:120766573-120766595 AAGGAGAAGATGAAGGGGTAAGG - Intronic
960869038 3:122230825-122230847 ACAGAGAAGTAGAAGGGGCCAGG - Intronic
961516426 3:127440237-127440259 ACTCAGAGGCTGAAGGGGGCTGG + Intergenic
961688131 3:128649772-128649794 AATGAGAAGCAGCAGGGGGAAGG + Intronic
961906205 3:130265189-130265211 ACAGTGAAGATTAAGGGGCAAGG + Intergenic
961963815 3:130881366-130881388 ACAAAGGAGGGGAAGGGGGAGGG - Intronic
962886633 3:139633689-139633711 ACACAGCAGCTGAAGGTGGGAGG + Intronic
963335720 3:143972022-143972044 ATAGAGGAGCGGGAGGGGGAGGG - Exonic
963387143 3:144611738-144611760 AGAGGGAAGCTGAGTGGGGAAGG - Intergenic
964210142 3:154217595-154217617 TCAGAGCAGCTGAAGGGAGATGG - Intronic
964607552 3:158573350-158573372 ACAGGGAAGCTGATGGGGCGGGG + Intronic
964833304 3:160910184-160910206 ACAGGGAAGGGGAAGGGGAAGGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
966248149 3:177831651-177831673 CCATAGAATCTGAAGGAGGAAGG - Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
967215319 3:187204732-187204754 ACAGAGAAGTTGAAGGTCCAGGG - Intergenic
968559181 4:1268202-1268224 AGATAGGAGCTGAAGGGGCACGG - Intergenic
968738073 4:2309227-2309249 GCAGAGAAGCAGGAGGGGAAGGG - Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
970466084 4:16324307-16324329 ACAGACCAGATGAAGGGGGAAGG - Intergenic
971296506 4:25398362-25398384 ACTGAGAAGGTGAAGTTGGAAGG + Intronic
971451239 4:26803907-26803929 AAAGAGAAGGGGACGGGGGAGGG + Intergenic
971551134 4:27956834-27956856 GAAGTGAAGCTAAAGGGGGAAGG - Intergenic
972427675 4:38949685-38949707 CCAGAGAAGGGGAAGGGAGAAGG - Intergenic
973078992 4:45966070-45966092 AGAGAGAAGCTGATAGTGGATGG - Intergenic
973218626 4:47700135-47700157 ACAGAAAATCTTAAGGGTGAAGG - Intronic
973598479 4:52516673-52516695 TCAGAGCAACTGAAGGAGGAAGG + Intergenic
973902688 4:55494141-55494163 ACATAAAACCTGAAGGTGGAGGG + Intronic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
975450975 4:74526337-74526359 AGAGAGAAAATGAAGAGGGAGGG + Intergenic
976096627 4:81515299-81515321 TTAGTGATGCTGAAGGGGGAAGG + Intronic
977765597 4:100794117-100794139 ACAGAGAATTTGAAGGGAAATGG - Intronic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
979006190 4:115300294-115300316 TCACAGAAGCAGAAGTGGGAGGG - Intergenic
979234138 4:118380587-118380609 ACAGAGAAGTTTAAGGGGGAAGG - Intergenic
980484491 4:133438126-133438148 GAAAACAAGCTGAAGGGGGAAGG + Intergenic
980963800 4:139501419-139501441 TCAGAGACTCAGAAGGGGGAGGG + Intronic
981199701 4:141966191-141966213 ACAGGGAAGCTCAAAGTGGATGG + Intergenic
981206946 4:142053360-142053382 AGAGAGAACCTGAAGAGAGATGG + Intronic
983353490 4:166625139-166625161 ACAGAGATCCTTAAGAGGGAGGG + Intergenic
983534713 4:168845050-168845072 GTAGAGAAGCTGGAGGGGGGAGG + Intronic
984552636 4:181179527-181179549 GCAGTGAAGCTGAAGAGAGATGG - Intergenic
984715580 4:182921521-182921543 ACAGCAGAGCTGAAGGCGGAGGG + Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985806051 5:2044260-2044282 ACAGAGAAGCTGGAGGGCACGGG + Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
985962952 5:3316760-3316782 AGAGAGCAGCTGCAGAGGGATGG - Intergenic
986918260 5:12652309-12652331 ACACAGTAGCTAAAGGAGGAGGG + Intergenic
987500179 5:18698782-18698804 AGATAGGAGCTGAAGGGGCATGG - Intergenic
988376159 5:30438837-30438859 AAAGAGAAACTGAAGACGGAAGG + Intergenic
988379204 5:30478784-30478806 ATAGAAAAGATGAAGGGAGAGGG - Intergenic
988381495 5:30502450-30502472 ACAGAAAAGCTGAGAGGGAATGG + Intergenic
989353235 5:40512476-40512498 ACAGAGAAGTTGAATGGAAATGG + Intergenic
989709315 5:44378141-44378163 CAACAGCAGCTGAAGGGGGATGG + Intronic
990021680 5:51135475-51135497 ACAGAGAGGTTTAATGGGGATGG - Intergenic
990390498 5:55314773-55314795 ACAGACCAGCAGTAGGGGGATGG + Intronic
991169012 5:63599161-63599183 ACAAAGAAGAGGGAGGGGGAGGG - Intergenic
991252912 5:64583475-64583497 ACAGAGCAGAGGTAGGGGGAGGG + Intronic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
992773469 5:80070041-80070063 GCAGAGCAGCAGAAGGGAGATGG - Intronic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993503275 5:88684912-88684934 AGAGAGAAGTAAAAGGGGGATGG + Intergenic
993693598 5:91033646-91033668 ACAGAGAATCAGAACTGGGAAGG - Intronic
993962285 5:94314087-94314109 TCAGAGAAGTTGAAGGTGGTAGG - Intronic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
995142021 5:108745489-108745511 GCAGAGTAGTTGGAGGGGGAGGG - Intergenic
995526645 5:113055453-113055475 AGAGAAAAGCTGAAGAGAGATGG + Intronic
995541282 5:113188553-113188575 ACACAAAAGCAGAAAGGGGAAGG + Intronic
996330193 5:122320039-122320061 CAAGAGAAGCTGAAGGCTGAGGG - Intronic
996749966 5:126878412-126878434 ACAGAGAAGAGCAAGGGAGAGGG + Intronic
996780513 5:127181702-127181724 TCAGAGAAGCTTAGTGGGGAAGG + Intergenic
996814600 5:127560836-127560858 ACACAGAAGCAGAAGAGGCAAGG - Intergenic
997225740 5:132208372-132208394 AGAGAGGAGGAGAAGGGGGAGGG + Intronic
997892874 5:137690500-137690522 GCAGAGAAGCAGAAGGGTCAAGG + Intronic
998495818 5:142588463-142588485 AGAGAGAAGAGGGAGGGGGAGGG - Intergenic
998549869 5:143067041-143067063 ACCAAGAAGCAGAAGCGGGAGGG - Intronic
999077007 5:148806022-148806044 AAAAAGAAGCTGGAGTGGGAGGG + Intergenic
999249670 5:150175082-150175104 ACAAAGAAGCTGAAAGAGGCAGG - Intronic
999272477 5:150304657-150304679 AAAGAGAAGCAGCAAGGGGATGG + Intronic
1000345092 5:160307743-160307765 TCAGAGGAGCTGAAGGGAGCGGG + Intronic
1001451011 5:171824372-171824394 ACAGAGAACCTGAAGAGCAAGGG + Intergenic
1002151184 5:177232539-177232561 ACATCTAAGCTGAAGGGTGATGG - Intronic
1002320719 5:178373980-178374002 ACTGAGAAGTTGAAGGGTGCGGG - Intronic
1002550890 5:179990783-179990805 AGATAGTAGCTGAAGGGGCATGG - Intronic
1002554102 5:180020780-180020802 ACACAGAGGCAGAAGGGGGGTGG + Intronic
1002746687 6:63169-63191 ACAGAGTAGCAGAGGGAGGATGG - Intergenic
1003427408 6:6006950-6006972 AGAGAGAGGCTGAGGGGGGGGGG + Exonic
1003790168 6:9537459-9537481 TCAGAGAAAATGAGGGGGGAGGG + Intergenic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1005103628 6:22200027-22200049 ACAGAGGAGCAGAGGGTGGAGGG - Intergenic
1005386845 6:25293722-25293744 AAAGGGAAGAGGAAGGGGGAAGG - Intronic
1005591914 6:27337474-27337496 ACAGAGAAGTTGAAGTGGAAGGG + Intergenic
1005808493 6:29497460-29497482 AGAGAGAGAGTGAAGGGGGAAGG - Intergenic
1006154709 6:32007919-32007941 CCGGAGATGCTGAAGGGGGCTGG - Intergenic
1006161021 6:32040654-32040676 CCGGAGATGCTGAAGGGGGCTGG - Exonic
1006964506 6:37968709-37968731 ACAGAGAAAGGGAAGCGGGAAGG - Intronic
1007128175 6:39445220-39445242 ACAGAGAAGATGAAGGGGCAGGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007649147 6:43406990-43407012 GGACAGTAGCTGAAGGGGGAAGG + Intergenic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1008046931 6:46860614-46860636 ACAGAGAAGCTGCAATGGGGAGG + Intronic
1008111248 6:47497362-47497384 ACAGGGAAGGAGAAGGGGAAGGG - Intronic
1008294903 6:49763668-49763690 AAGGAGAAGTTGAAGGGGTAAGG - Intergenic
1008672996 6:53793062-53793084 ACAGAGAAGCTGAAGCATCATGG + Intergenic
1010068889 6:71719836-71719858 AGAGAGAGGCTGAAGCGGGTGGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1011290655 6:85773159-85773181 ACATAGAAGCTGAAATGGAAGGG - Intergenic
1012615507 6:101273637-101273659 ACAAAGGAACTGAAGGGGAAAGG + Intergenic
1012677826 6:102138945-102138967 ACAAAGAAAGTGAAGGGGGGAGG + Intergenic
1012785789 6:103624027-103624049 ACAGAGAAGCAGAAGTGAAAGGG - Intergenic
1014623383 6:123697027-123697049 TCAGAGATTCTGCAGGGGGAAGG - Intergenic
1015276156 6:131385284-131385306 AGAGACAACCTGAAGGGGGTGGG + Intergenic
1015313925 6:131795543-131795565 GCAGAGAGAGTGAAGGGGGAGGG + Intergenic
1015554105 6:134443196-134443218 AGAGAGAAGTTGAAGAGGGGTGG + Intergenic
1015814244 6:137191690-137191712 CCAGAGATGGTGAAGGGGGAAGG + Intergenic
1015843586 6:137496540-137496562 AGAGAGAGGCGGACGGGGGAGGG + Intergenic
1015906634 6:138123648-138123670 GCAGAGAAGATGGAGAGGGATGG - Intergenic
1016230901 6:141802972-141802994 ACATAAATGCTTAAGGGGGATGG - Intergenic
1017744697 6:157436053-157436075 ACTGAGTAGCTGATGAGGGAAGG + Intronic
1017847011 6:158267538-158267560 ACAGAGCAACAGAAGTGGGAGGG - Intronic
1017879338 6:158548889-158548911 GCAGAGAAGGTGAAGGGTGTTGG + Intronic
1018724397 6:166599701-166599723 ACAAATAAGCTGTAGGGGGAGGG + Intronic
1018768341 6:166951611-166951633 AGATAGGAGCTGAAGGGGCACGG - Intronic
1018885411 6:167931283-167931305 GCAGGGAAACTGAAGGGGGCAGG + Intronic
1019273955 7:166219-166241 ACAGAGAATAGGAAGGAGGAAGG - Intergenic
1019875039 7:3802580-3802602 ACAGGGCAGCACAAGGGGGATGG - Intronic
1020059891 7:5144158-5144180 GCAGAGAAGCTCCAGGGGAAGGG + Intergenic
1020093993 7:5357588-5357610 CCAGAAAAGCTGAGGCGGGAGGG - Intronic
1020111661 7:5451261-5451283 CCAGAGGAGCTGGAGGGGGGTGG - Intronic
1020168075 7:5823593-5823615 GCAGAGAAGCTCCAGGGGAAGGG - Intergenic
1020409126 7:7871148-7871170 ACAGACAGGCTGAAGAAGGATGG - Intronic
1021482786 7:21136264-21136286 ACAAAGAAGGTGCAGGGTGAAGG + Intergenic
1021981012 7:26055644-26055666 AGAGAGAAGCTGAAAGTGAATGG + Intergenic
1022324200 7:29315835-29315857 AGAGAGAAGATTAAGTGGGAAGG + Intronic
1023826518 7:44013703-44013725 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1024058600 7:45682194-45682216 ACAGAGAAGCTGCATGGGGGTGG + Intronic
1024428160 7:49253757-49253779 ACAGAAAAAGTGAAGGGAGAAGG + Intergenic
1024693517 7:51829461-51829483 ACAGAGAAGCTGAAAACTGAGGG + Intergenic
1024702245 7:51916746-51916768 AGAGAGAGAGTGAAGGGGGAAGG + Intergenic
1026090096 7:67292573-67292595 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1026455642 7:70570309-70570331 ACAGACAAGATGCTGGGGGAAGG - Intronic
1026455676 7:70570627-70570649 ACAGAGAAGGGTAAAGGGGAAGG - Intronic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027119687 7:75507891-75507913 ACAGAGAGAGTGAAGTGGGAGGG + Intergenic
1027272138 7:76527720-76527742 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1027608122 7:80325342-80325364 CCAGAGAGGCTGAAGTGAGAGGG + Intergenic
1028555592 7:92120528-92120550 ACTGAGAAGCTGAGATGGGAAGG - Intronic
1029419362 7:100464518-100464540 TCAGGAAAGCTGAAGGGGGCCGG + Intronic
1029575785 7:101402426-101402448 CCAGAGAAGGGGAAAGGGGAAGG - Intronic
1029717810 7:102342136-102342158 ACAGAGAGAGTGAAGTGGGAGGG - Intergenic
1029754805 7:102567107-102567129 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1029772755 7:102666187-102666209 ACAGAGAGAGTGAAGTGGGAGGG + Intronic
1029974986 7:104825329-104825351 ACAGAGCAGCTGATGTGTGATGG - Intronic
1030339441 7:108360224-108360246 ACAGAGAAGGAGAAGTGAGAAGG + Intronic
1030396013 7:108987957-108987979 ACAGAGAAACTGAAGAAGAATGG + Intergenic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1030889365 7:114980332-114980354 ACAGTGAGGCTGAAATGGGATGG - Intronic
1031991439 7:128201578-128201600 ACAGAGAAGCCGGCGGAGGAAGG - Intergenic
1033077055 7:138259386-138259408 AGGGAGTAGATGAAGGGGGAGGG + Intergenic
1033242820 7:139694741-139694763 ACAGAGAAGGTGGAGGATGAGGG + Intronic
1033283711 7:140023287-140023309 ACAGTGAAGCTGAAGGTTCAGGG - Intergenic
1033804372 7:144937544-144937566 AAAGGGAAGGGGAAGGGGGAAGG - Intergenic
1033932774 7:146545083-146545105 ACAGAGAAGCTCAGGTAGGAGGG + Intronic
1034200464 7:149280477-149280499 AGATAGAAGCTGGAGAGGGAGGG - Intronic
1034221971 7:149453874-149453896 TCAGAGAAGCTGCTGGGGCAAGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035219562 7:157397786-157397808 ACATAGAAGCTGAATTGAGAAGG - Intronic
1035494422 7:159310774-159310796 ACAGAAAAGCTGATGGGGGTGGG + Intergenic
1036419610 8:8583552-8583574 GGAGAGAACCTGAAGTGGGATGG + Intergenic
1037644166 8:20775124-20775146 ACAGAGAAGCCAAAGGGGTGAGG - Intergenic
1037764884 8:21766623-21766645 AAAGAGGGGCTCAAGGGGGAGGG - Intronic
1037795888 8:21994519-21994541 CCAGAGACGGTGTAGGGGGAAGG + Intronic
1038036736 8:23692440-23692462 GCAGGGAGGCTGAAGTGGGAGGG + Intergenic
1038298900 8:26323838-26323860 ACAGAGAAGTGGAAGGGAGTGGG - Intronic
1038519040 8:28213598-28213620 AGAGTGCAGCTGAAGGGGGCTGG + Intergenic
1038712373 8:29959389-29959411 AAAGAGAAGATGAAGGAAGAGGG + Intergenic
1038794749 8:30699951-30699973 AAAGAGAAGCTGTAAGAGGAGGG + Intronic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1040858090 8:51970762-51970784 ACTCAGAAGTGGAAGGGGGAAGG - Intergenic
1040907006 8:52479565-52479587 ACAGATGAGTTGAAGGGTGAAGG - Intergenic
1040913606 8:52545553-52545575 TAAGACAAGTTGAAGGGGGATGG - Intronic
1040919946 8:52605032-52605054 ACACAGAAGCTGAAGAGGCCAGG - Intergenic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1042348385 8:67750784-67750806 ACAGAAAGGCTGAATGGAGATGG - Intergenic
1042701876 8:71624540-71624562 TCAGAGAAGCTGTAGGAGGAAGG - Intergenic
1042966834 8:74362581-74362603 AAAGAGTAGCTGAAGGGTCAGGG - Intronic
1043305175 8:78784865-78784887 AAGGAGAAGATGGAGGGGGAGGG - Intronic
1043766029 8:84133423-84133445 AGAGAGAAGCTGAGGTGGAAGGG + Intergenic
1044466456 8:92512505-92512527 ACAGAGAAGCTGGGGGGAAATGG - Intergenic
1044622930 8:94208409-94208431 ACAAAGTAGATGGAGGGGGAGGG - Intronic
1045009234 8:97943382-97943404 ACAGAGAAGGAGAAGGAGAAAGG - Intronic
1045417386 8:101980674-101980696 AAATAGAAGCTCAAGGGGGCAGG + Intronic
1046496791 8:115024673-115024695 ACAGAGAAGCTACAGGGCAAGGG - Intergenic
1047107494 8:121749296-121749318 ACAAATAAGCAGGAGGGGGAAGG + Intergenic
1047500167 8:125434076-125434098 ACAGAGAACCTGGACTGGGATGG - Intronic
1047531654 8:125682334-125682356 ACATTGCAGCTGAAGGGGGCTGG + Intergenic
1048448788 8:134513087-134513109 ACAGGGCAGCTGATGGTGGAAGG + Intronic
1048957285 8:139547555-139547577 ACAGAGATGCTGAAGTGTGGAGG - Intergenic
1049253189 8:141600192-141600214 ACCTAGAGGCTGGAGGGGGAAGG + Intergenic
1049277171 8:141725713-141725735 GCAGAGCAGCTGCAGAGGGAGGG - Intergenic
1049326225 8:142022903-142022925 ACAGAGCAGCTGGTGGGAGAAGG + Intergenic
1049334292 8:142074592-142074614 ACAGAGCAGCTGAAGGGCTCAGG + Intergenic
1049375838 8:142288663-142288685 ACAGAGGAGCTGGTGGGGGGTGG + Intronic
1049623766 8:143611093-143611115 ACGGAGAAGCTGAACGGGGCTGG - Intergenic
1050000577 9:1073104-1073126 AAAGAGAAGCTATAAGGGGAAGG - Intergenic
1050418119 9:5435459-5435481 AGAGTGAAGCTGGAGGAGGATGG - Intronic
1050490862 9:6186557-6186579 AGGGAGAAGGTGAAGGGGAAGGG + Intergenic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1050985937 9:12082310-12082332 AGAGAGAAGTGGAAGGAGGAAGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1052184879 9:25580672-25580694 GCAGAGAAGATGAAGATGGAAGG - Intergenic
1052838061 9:33265898-33265920 AAAGAGGAGCTTAAGGGGAAGGG - Intronic
1052968769 9:34363625-34363647 AGAGAGCAGCAGCAGGGGGAAGG - Intergenic
1054825388 9:69567829-69567851 GCAGAGATGCTCAAGGTGGAGGG - Intronic
1055202525 9:73684312-73684334 ACACAGGAGCTGAAGGGGCCAGG + Intergenic
1055240292 9:74176524-74176546 ACAGAGAAGAGCAAGGAGGAGGG - Intergenic
1055283518 9:74702535-74702557 AAAGAGAACCTCAAGGGAGAAGG + Intergenic
1055667600 9:78568166-78568188 ACAAATAAGCTGATGGGGAACGG + Intergenic
1055971232 9:81915063-81915085 AGAGAGAAGCCGAAGAGGAAAGG + Intergenic
1056331135 9:85522260-85522282 CCAGAGCTGCTAAAGGGGGATGG + Intergenic
1056492849 9:87125015-87125037 TCAGAGAAGCTGAGGTGGGGCGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1058270689 9:102968145-102968167 AGAGTGAGGCTGAGGGGGGAGGG - Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058860149 9:109108678-109108700 ACAGAAAAGATGAAGGTTGATGG + Intronic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059433957 9:114265489-114265511 GCAAAGAAGCAGAAGAGGGAAGG - Intronic
1060262046 9:122084269-122084291 ACAGAGAAGCATATGGGAGAGGG + Intronic
1060268610 9:122126428-122126450 AATGTGAAGCTGGAGGGGGAGGG + Intergenic
1060417057 9:123438299-123438321 ACAGATTAGCTGCAGAGGGAGGG - Intronic
1061125294 9:128671189-128671211 CCAGAGAGGCTGAGGTGGGAGGG + Intergenic
1061297742 9:129686156-129686178 CCAGTGAAGCTGGAGGGGGCAGG + Intronic
1061649474 9:132035485-132035507 ACAGGGAAGCAGATGGGGGGTGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1203563696 Un_KI270744v1:76690-76712 ACTGAGAGGGTGCAGGGGGATGG - Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1186876127 X:13820009-13820031 ACAGAGGGACTGAAGGGAGATGG + Intronic
1187467905 X:19542744-19542766 AGAAAGAAGCTGCAGCGGGAGGG + Intronic
1187470542 X:19565599-19565621 AGAGGGGAGATGAAGGGGGAGGG + Intronic
1188974569 X:36657575-36657597 AAAGAGGAGCTGAAGAGGGTAGG - Intergenic
1189239434 X:39514374-39514396 GCAGAGAAGTTGAACTGGGATGG - Intergenic
1189326052 X:40111756-40111778 ACAGAGAAACTGGGGGGGAAGGG - Intronic
1190245420 X:48687540-48687562 ACAGACAAGGTGGATGGGGATGG + Intronic
1190260139 X:48792241-48792263 ACAGGGAAGTTGAGGTGGGAGGG + Intronic
1190339099 X:49282189-49282211 ACTCAGAACCTGATGGGGGAGGG + Intronic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1192157398 X:68756880-68756902 AGAGAGAAGCAGCAGGGAGATGG + Intergenic
1192872567 X:75198818-75198840 ACAGAGCTGCTGCTGGGGGATGG - Intergenic
1193611407 X:83635500-83635522 AGATAGGAGCTGAAGGGGCAAGG - Intergenic
1194961347 X:100239660-100239682 AAAGAGAAAATGAAGCGGGAAGG + Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1195223365 X:102767834-102767856 ACCAAGAAGTTGAAGGGAGAGGG + Intergenic
1195273324 X:103254414-103254436 TAAGAGACGCTGAAGGGGGAGGG - Intronic
1195670678 X:107467222-107467244 ACAGATAAGCTGTAGGAAGATGG + Intergenic
1196811639 X:119633666-119633688 ACAGGGATTCTGGAGGGGGATGG + Intronic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197428600 X:126329301-126329323 ACTAAGAATCTAAAGGGGGATGG + Intergenic
1197854041 X:130895697-130895719 ACAGAGCACCAGAAAGGGGAGGG + Intronic
1198302351 X:135344694-135344716 ACAGGGATGCTGACGTGGGAGGG - Intergenic
1198649816 X:138850074-138850096 ACACATAAGCTCAAGGGAGAGGG + Intronic
1199813867 X:151379243-151379265 ACAGAGAAGCTCATGTGGTAAGG + Intergenic
1201452431 Y:14130576-14130598 GAAGAGAAGGTGAAGAGGGAAGG - Intergenic