ID: 1148854745

View in Genome Browser
Species Human (GRCh38)
Location 17:50572578-50572600
Sequence CTATTACCAGACAGAGAACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 96}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1148854735_1148854745 13 Left 1148854735 17:50572542-50572564 CCCATCCTGCAGCCCCCTGAGCG 0: 1
1: 0
2: 0
3: 11
4: 156
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854732_1148854745 19 Left 1148854732 17:50572536-50572558 CCCCTTCCCATCCTGCAGCCCCC 0: 1
1: 0
2: 9
3: 127
4: 1102
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854731_1148854745 25 Left 1148854731 17:50572530-50572552 CCTGTTCCCCTTCCCATCCTGCA 0: 1
1: 0
2: 4
3: 75
4: 693
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854733_1148854745 18 Left 1148854733 17:50572537-50572559 CCCTTCCCATCCTGCAGCCCCCT 0: 1
1: 0
2: 6
3: 133
4: 695
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854740_1148854745 1 Left 1148854740 17:50572554-50572576 CCCCCTGAGCGTGGACCTGGAGC 0: 1
1: 0
2: 1
3: 15
4: 119
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854741_1148854745 0 Left 1148854741 17:50572555-50572577 CCCCTGAGCGTGGACCTGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 92
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854742_1148854745 -1 Left 1148854742 17:50572556-50572578 CCCTGAGCGTGGACCTGGAGCGC 0: 1
1: 0
2: 0
3: 4
4: 88
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854734_1148854745 17 Left 1148854734 17:50572538-50572560 CCTTCCCATCCTGCAGCCCCCTG 0: 1
1: 0
2: 11
3: 77
4: 704
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854736_1148854745 12 Left 1148854736 17:50572543-50572565 CCATCCTGCAGCCCCCTGAGCGT 0: 1
1: 0
2: 0
3: 28
4: 252
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854743_1148854745 -2 Left 1148854743 17:50572557-50572579 CCTGAGCGTGGACCTGGAGCGCT 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854738_1148854745 8 Left 1148854738 17:50572547-50572569 CCTGCAGCCCCCTGAGCGTGGAC 0: 1
1: 0
2: 1
3: 17
4: 202
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854729_1148854745 27 Left 1148854729 17:50572528-50572550 CCCCTGTTCCCCTTCCCATCCTG 0: 1
1: 0
2: 2
3: 73
4: 723
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96
1148854730_1148854745 26 Left 1148854730 17:50572529-50572551 CCCTGTTCCCCTTCCCATCCTGC 0: 1
1: 0
2: 6
3: 84
4: 814
Right 1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1148854745 Original CRISPR CTATTACCAGACAGAGAACG AGG Exonic
901613943 1:10522320-10522342 TTGTTGCCAGACAGAGAACGAGG + Intronic
906004961 1:42461177-42461199 CTATTATCAGACAGACACAGGGG - Intronic
908918862 1:69166246-69166268 TTATTACCAGACAGAGTACAGGG + Intergenic
910089554 1:83446030-83446052 CTATTACCAGTCAGAGGATGGGG + Intergenic
910219496 1:84876216-84876238 TTACTACCAGACAGAACACGGGG - Intronic
913576282 1:120178507-120178529 CTATTAACAGAGACAGAAAGTGG + Intergenic
918135214 1:181667207-181667229 CTAGTTCCAGACAGAAAATGAGG + Intronic
1064760043 10:18609333-18609355 TTATTACTGGACAGAGAAGGTGG + Intronic
1066360486 10:34725928-34725950 CTGTTACATGACTGAGAACGTGG - Intronic
1071913325 10:90260981-90261003 CTGTTACCAGATAGTGCACGGGG + Intergenic
1075832764 10:125425330-125425352 TTGTTACCAGACAGGGAAGGAGG - Intergenic
1076367126 10:129928608-129928630 ATATTCCTAGACAGAGAATGTGG + Intronic
1082776649 11:57250268-57250290 GTATTTCCAGAAAGAGAAAGAGG - Intergenic
1084960848 11:72715529-72715551 ATATTCCCAGGCAGAGAACAGGG - Intronic
1088185774 11:107168036-107168058 ATAATACCAGCCAGAGAAAGAGG - Intergenic
1088357417 11:108958479-108958501 CTCTTACATGTCAGAGAACGGGG - Intergenic
1091044506 11:132313713-132313735 CTATTACCAGGCAGATAAAAGGG - Intronic
1091207611 11:133832473-133832495 CTATGAAGACACAGAGAACGAGG + Intergenic
1102310291 12:111839488-111839510 CTATTACAAGACATAGAGCCTGG + Intergenic
1110527529 13:76556177-76556199 CTCTTTCCAGACAGAGAAAAGGG + Intergenic
1115958982 14:38813358-38813380 CTATTCCAAGAGAGAGAAAGAGG + Intergenic
1118008781 14:61589429-61589451 CTATTACCTTACAGAGAACCAGG - Intronic
1118074341 14:62281906-62281928 CTAATACCAGAGAGAGAGGGAGG - Intergenic
1122988776 14:105226489-105226511 CTATGACCAGCCAGAGCCCGAGG - Intronic
1124177470 15:27439793-27439815 CTATTTCCAGACAGATCACTGGG + Intronic
1130905586 15:88238702-88238724 ATGTTACCACACAGAGAACAAGG + Intronic
1132049011 15:98591572-98591594 CTATGACGAGAGAGAGAAAGTGG - Intergenic
1141042724 16:80685725-80685747 CAATTTACAGTCAGAGAACGAGG + Intronic
1144397874 17:14862840-14862862 CTACAACCAGACAGAGATTGAGG + Intergenic
1146284742 17:31566841-31566863 CCATCACCAGACACAGAAGGAGG - Intergenic
1146353432 17:32114897-32114919 CTATCACCACATAGAGAAGGGGG + Intergenic
1147685964 17:42287136-42287158 CTGTGACCACACAGAGAAGGTGG + Intergenic
1148854745 17:50572578-50572600 CTATTACCAGACAGAGAACGAGG + Exonic
1150756846 17:67922379-67922401 CTATCACCGCACAGAGAAGGGGG - Intronic
1155196774 18:23482729-23482751 CTATTACCAGACAGAAAGTTTGG - Exonic
1156504281 18:37579307-37579329 CCATTACCAGACAGTGAGTGTGG - Intergenic
1158444506 18:57507600-57507622 CTCTTACCAGGGAGAGAAGGTGG - Intergenic
1159425813 18:68284773-68284795 CATTTACCAGAAAGAGAATGGGG - Intergenic
1167995107 19:53395582-53395604 CCAGGACCAGACAGAGGACGCGG - Intronic
1167999364 19:53432395-53432417 CTAGGACCAGGCAGAGGACGCGG - Intronic
1168560706 19:57380413-57380435 CTATTACATGACACAGAACCTGG - Intronic
926835370 2:17013346-17013368 CAAGTACAAGACAGAGAACGAGG + Intergenic
929077094 2:38086803-38086825 CTAATACCAGACAGAGCTCATGG - Intronic
932035193 2:68238382-68238404 CGTTTGCCAGACAGAGAAAGGGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
935470952 2:103460266-103460288 CTATAACCAGCCAGAGAATCTGG + Intergenic
939471159 2:142622361-142622383 CTAATACCAGACAGTAAATGAGG + Intergenic
943101757 2:183495423-183495445 CTATTTTCAGAGAGATAACGGGG + Intergenic
945181145 2:207092425-207092447 TTGTTGCCAGACAGAGAAAGTGG - Intronic
945986972 2:216362788-216362810 CTTTTACCATACACAGAAGGAGG + Intronic
1169356502 20:4911021-4911043 CGATCTCCAGACAGAGAAGGAGG + Intronic
1174435312 20:50502232-50502254 CTCTTACCAGACAGGCAGCGTGG + Intergenic
1176773634 21:13108113-13108135 CTATATCCAAACAAAGAACGTGG + Intergenic
1177392615 21:20495762-20495784 CTATTACCAGACAGAACACATGG - Intergenic
1180898893 22:19356883-19356905 CTCTCACCAGACAGAGAGTGTGG + Exonic
1184909603 22:47520152-47520174 CTGTTACTAGACAGAGACTGGGG - Intergenic
961780580 3:129317988-129318010 GAATTTCCTGACAGAGAACGGGG + Intergenic
967576570 3:191101877-191101899 CTAGTACCAGAAAGAGACTGAGG + Intergenic
968161667 3:196432106-196432128 CTACTAGGAGACAGAGAACGAGG + Intronic
970811305 4:20097729-20097751 ATATTACCAGACAGGAAAAGAGG - Intergenic
975066249 4:70067714-70067736 CCATTTCCAGACGGAGAAAGTGG - Intergenic
980337256 4:131492556-131492578 CTATTTCAAGGCAGAGTACGTGG + Intergenic
981353877 4:143764875-143764897 CTGTTACCAGACACTGAACCTGG + Intergenic
981781802 4:148439516-148439538 CTATGACCAGGAAGAGAATGAGG - Intronic
989162707 5:38406973-38406995 CCATTCCCATACAGAGAAAGGGG + Exonic
992677373 5:79118751-79118773 CTACTGCCAGGCAGAGAAGGTGG - Intronic
992912014 5:81404897-81404919 GTATCAGCAGACAGAAAACGTGG - Intergenic
997093622 5:130885689-130885711 CTATAACCACTCAGTGAACGTGG - Intergenic
1001249341 5:170134514-170134536 CTGTTACCAGAAAGAGGAGGTGG - Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1005922043 6:30410743-30410765 GTATTACCAGAGAGAAAAAGAGG - Intergenic
1011311212 6:85981594-85981616 CTTTTACCAGACAGATCACCAGG - Intergenic
1011466248 6:87660019-87660041 CTTTTACCAGGCAGTGAACATGG + Intronic
1013383040 6:109596391-109596413 CTTTTCCCAGGCAGAGAACTTGG - Intronic
1015604186 6:134938388-134938410 CTATTAGCAGAAAAAGAACAAGG + Intronic
1021229006 7:18062902-18062924 CTGGTAGCAGACACAGAACGTGG + Intergenic
1022036639 7:26541016-26541038 CTCTTACCAAACAGAGACCTTGG - Intergenic
1022262249 7:28717670-28717692 CTCTTAAGAGAGAGAGAACGAGG - Intronic
1022295405 7:29046655-29046677 CTATAACCAGACAGAGAAAAGGG + Intronic
1023274692 7:38505650-38505672 CTATTTCCAGAGAGAGGAAGAGG + Intronic
1027306412 7:76902468-76902490 CTATTACCGGTCAGAGAATGGGG + Intergenic
1029483439 7:100826077-100826099 TTCATACCAGACAGAGAAAGGGG + Intronic
1030552252 7:110977182-110977204 CTAGTACCATACAGAGTACCTGG - Intronic
1031673796 7:124584932-124584954 CTACTACTAGACAGAGATCCTGG + Intergenic
1033516869 7:142115391-142115413 CTGTTAGCAGATAGAGAGCGAGG + Intronic
1034206359 7:149319118-149319140 CTAGGACCAGAGAGAGAATGGGG + Intergenic
1041963615 8:63648785-63648807 ATATTGCCAAAAAGAGAACGGGG + Intergenic
1041964013 8:63653361-63653383 CTTTTAGCAGACAGAGCAGGAGG - Intergenic
1043736976 8:83760768-83760790 CTACTACCAAACATGGAACGGGG + Intergenic
1044328261 8:90885453-90885475 CTATGACCAAAAAGAGAATGAGG + Intronic
1045485487 8:102627974-102627996 CACTTACCAGTCAGAGAACCCGG - Intergenic
1047777644 8:128086702-128086724 TTTTTACCAGAAAGAGAAGGAGG - Intergenic
1050027546 9:1351477-1351499 CTATTACCTGACAGATGAGGAGG + Intergenic
1050756608 9:9012002-9012024 CTATTACCAGACTGATAGCAAGG - Intronic
1053035481 9:34823867-34823889 CTATCACCAGACTGAGATCCTGG + Intergenic
1054846367 9:69802771-69802793 CTATTACCAGAACGAAAATGTGG + Intergenic
1057043858 9:91868837-91868859 TTAATACCAGAAAGAGAACTTGG + Intronic
1058391892 9:104504755-104504777 CTATTACCACAGAGAGACAGTGG - Exonic
1059079781 9:111236270-111236292 CTATCACCTAACAGAAAACGTGG - Intergenic
1059315882 9:113425504-113425526 CTATAACCAGATAGAAAACAAGG - Intronic
1060575563 9:124689730-124689752 TTTTTACTAGACAGAGAAAGGGG - Intronic
1203760339 EBV:9812-9834 CTTTTTCCAGACAAAGGACGAGG + Intergenic
1187589133 X:20696758-20696780 CTATTCCAAAACAGAGAAAGAGG + Intergenic
1187770691 X:22692477-22692499 CTAGTACCCGACAAAGAACTTGG - Intergenic
1195099159 X:101537805-101537827 GCTTTTCCAGACAGAGAACGTGG + Intergenic
1196135792 X:112208410-112208432 CTATGACCAGTCTGAGAACTTGG - Intergenic
1197545546 X:127819489-127819511 CTATTCCAAGATAGAGAAAGAGG + Intergenic